ID: 914480229

View in Genome Browser
Species Human (GRCh38)
Location 1:148059776-148059798
Sequence TCCTATCCCCAGGATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914480229_914480231 -8 Left 914480229 1:148059776-148059798 CCAGGCACATCCTGGGGATAGGA No data
Right 914480231 1:148059791-148059813 GGATAGGATACTACTGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914480229 Original CRISPR TCCTATCCCCAGGATGTGCC TGG (reversed) Intergenic
No off target data available for this crispr