ID: 914482474

View in Genome Browser
Species Human (GRCh38)
Location 1:148078937-148078959
Sequence TGGCCCCGATTTCCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914482474_914482477 -10 Left 914482474 1:148078937-148078959 CCAGTTCCGGGAAATCGGGGCCA No data
Right 914482477 1:148078950-148078972 ATCGGGGCCAGGAATCTATGAGG No data
914482474_914482481 24 Left 914482474 1:148078937-148078959 CCAGTTCCGGGAAATCGGGGCCA No data
Right 914482481 1:148078984-148079006 AGAGAACACAGCGCTCTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914482474 Original CRISPR TGGCCCCGATTTCCCGGAAC TGG (reversed) Intergenic
No off target data available for this crispr