ID: 914482582

View in Genome Browser
Species Human (GRCh38)
Location 1:148079336-148079358
Sequence TCCGGCTGGTCTGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914482570_914482582 16 Left 914482570 1:148079297-148079319 CCGAGTGCGGGGCCCGCCAAGCC 0: 237
1: 383
2: 328
3: 217
4: 228
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482572_914482582 3 Left 914482572 1:148079310-148079332 CCGCCAAGCCCACGCCCACCCTG No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482574_914482582 -5 Left 914482574 1:148079318-148079340 CCCACGCCCACCCTGAACTCCGG No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482573_914482582 0 Left 914482573 1:148079313-148079335 CCAAGCCCACGCCCACCCTGAAC No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482567_914482582 27 Left 914482567 1:148079286-148079308 CCCTCACTGCTCCGAGTGCGGGG No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482571_914482582 4 Left 914482571 1:148079309-148079331 CCCGCCAAGCCCACGCCCACCCT No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482576_914482582 -6 Left 914482576 1:148079319-148079341 CCACGCCCACCCTGAACTCCGGC No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data
914482569_914482582 26 Left 914482569 1:148079287-148079309 CCTCACTGCTCCGAGTGCGGGGC No data
Right 914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914482582 Original CRISPR TCCGGCTGGTCTGCAAGCGC CGG Intergenic
No off target data available for this crispr