ID: 914482999

View in Genome Browser
Species Human (GRCh38)
Location 1:148083074-148083096
Sequence GGTCAGACTGAAGCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914482993_914482999 4 Left 914482993 1:148083047-148083069 CCATCTCAGTGGGCCTTGCCTCT No data
Right 914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG No data
914482995_914482999 -9 Left 914482995 1:148083060-148083082 CCTTGCCTCTCCCTGGTCAGACT No data
Right 914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914482999 Original CRISPR GGTCAGACTGAAGCACAAGC TGG Intergenic
No off target data available for this crispr