ID: 914484507

View in Genome Browser
Species Human (GRCh38)
Location 1:148095600-148095622
Sequence AGAGAGAATCTAATGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914484496_914484507 15 Left 914484496 1:148095562-148095584 CCTATGACACCTCTCCCCCAACC No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484502_914484507 -2 Left 914484502 1:148095579-148095601 CCAACCACAGGAAATTCTCTGAG No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484500_914484507 0 Left 914484500 1:148095577-148095599 CCCCAACCACAGGAAATTCTCTG No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484503_914484507 -6 Left 914484503 1:148095583-148095605 CCACAGGAAATTCTCTGAGAGAG No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484498_914484507 6 Left 914484498 1:148095571-148095593 CCTCTCCCCCAACCACAGGAAAT No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484501_914484507 -1 Left 914484501 1:148095578-148095600 CCCAACCACAGGAAATTCTCTGA No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data
914484499_914484507 1 Left 914484499 1:148095576-148095598 CCCCCAACCACAGGAAATTCTCT No data
Right 914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914484507 Original CRISPR AGAGAGAATCTAATGGCTTG GGG Intergenic
No off target data available for this crispr