ID: 914486019

View in Genome Browser
Species Human (GRCh38)
Location 1:148110446-148110468
Sequence TACGAGGCCAACCTTTCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 11, 2: 1, 3: 2, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914486015_914486019 12 Left 914486015 1:148110411-148110433 CCTCTAATGAGTGAAATGTGCTG 0: 11
1: 2
2: 4
3: 10
4: 126
Right 914486019 1:148110446-148110468 TACGAGGCCAACCTTTCAGGAGG 0: 1
1: 11
2: 1
3: 2
4: 31
914486014_914486019 30 Left 914486014 1:148110393-148110415 CCATGCAGACTTGCTGTTCCTCT 0: 13
1: 0
2: 5
3: 24
4: 243
Right 914486019 1:148110446-148110468 TACGAGGCCAACCTTTCAGGAGG 0: 1
1: 11
2: 1
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914486019 Original CRISPR TACGAGGCCAACCTTTCAGG AGG Exonic
900574004 1:3374092-3374114 CACGAGGCAAACCTCTCAGGAGG + Intronic
902460193 1:16569141-16569163 TACGAGGCCAACATTTCAGGAGG + Exonic
913605224 1:120459440-120459462 TACGAGGCCAACATTTCAGGAGG - Intergenic
913642090 1:120822177-120822199 TACGAGGCTAACATTTCAGGAGG - Exonic
913989946 1:143601854-143601876 TACGAGGCTGACTTGTCAGGAGG + Intergenic
914083314 1:144429768-144429790 TACGAGGCCAACATTTCAGGAGG + Exonic
914189338 1:145395046-145395068 TACGAGGCCAACATTTCAGGAGG + Exonic
914211187 1:145580758-145580780 TACGAGGCCAACATTTCAGGAGG + Intergenic
914276390 1:146128187-146128209 TACGAGGCCAACATTTCAGGAGG + Exonic
914366428 1:146983001-146983023 TATGAGGCCAACCTTTCAGGAGG - Exonic
914486019 1:148110446-148110468 TACGAGGCCAACCTTTCAGGAGG + Exonic
914537434 1:148579142-148579164 TACGAGGCCAACATTTCAGGAGG + Exonic
914586350 1:149065594-149065616 TACGAGGCCAACATTTCAGGAGG + Exonic
914628492 1:149486203-149486225 TACGAGGCCAACATTTCAGGAGG - Intergenic
917886184 1:179387457-179387479 TAAGAGGTGGACCTTTCAGGAGG - Intronic
922220956 1:223558252-223558274 TGCGAGCCCAATCTCTCAGGAGG - Intronic
1063223527 10:3993038-3993060 TACGAGGCCAACTTTCTAGCAGG + Intergenic
1092124184 12:6064234-6064256 GACGAAGCATACCTTTCAGGAGG + Exonic
1092740336 12:11622527-11622549 TACCAGGCCAATATTTCAAGGGG - Intergenic
1099857962 12:88192338-88192360 TCAGAGGGCAACCTATCAGGAGG - Intronic
1107740986 13:43450393-43450415 GACGAGGCCAACAGATCAGGAGG + Intronic
1118865318 14:69698586-69698608 TTGCAGGCCAACCTTTCAGAAGG - Intronic
1126943281 15:53789394-53789416 TGGGTTGCCAACCTTTCAGGAGG - Intergenic
1131180844 15:90238661-90238683 TCCAGGGCCAACCTTTCAAGGGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1139266971 16:65649049-65649071 TACAAGGCCAACGTTACTGGAGG + Intergenic
1147541531 17:41364213-41364235 TACCAGTCCTACCTTACAGGTGG - Intronic
1157440111 18:47704494-47704516 TACTGGGCCACCCATTCAGGAGG - Intergenic
1202676625 1_KI270711v1_random:12869-12891 TACGAGGCCAACATTTCAGGAGG + Intergenic
930333231 2:50013419-50013441 TACCAGGCCAACAATTCAAGAGG - Intronic
931634400 2:64328560-64328582 TAGGAGGCCAGCATTTCAGTAGG + Intergenic
931900731 2:66785173-66785195 TAAGAGGTAAACATTTCAGGTGG + Intergenic
946049115 2:216846956-216846978 TAAGAGGCAAGCCTTTCAGGAGG - Intergenic
948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG + Intergenic
1170329243 20:15190586-15190608 TATGAGGCCAACAGGTCAGGAGG + Intronic
1173670877 20:44798081-44798103 TACACGGCCAACTTTTCATGAGG + Intronic
951110289 3:18795254-18795276 TAGGAGGCCAACCACTAAGGAGG + Intergenic
953752893 3:45623002-45623024 AACGTGGACAACCTTTCTGGAGG - Intronic
971726880 4:30326068-30326090 TACCAGGCCTACCTTACAGAAGG - Intergenic
978880198 4:113693092-113693114 TACTAAGCCAACCTTTCTGAGGG + Intronic
1023471958 7:40532102-40532124 TATGAGACCAACCTTGCAGTTGG - Intronic
1024177073 7:46851489-46851511 TACTATGACAACCTTTCACGAGG - Intergenic
1035192844 7:157187290-157187312 TATGAGTCCAGCCTTTCAGATGG - Intronic
1044767478 8:95592192-95592214 TACGAGGCCTGCCTTACAAGAGG - Intergenic
1047327211 8:123851380-123851402 TACTTGGCAAACCTTTCAGCTGG + Intergenic
1056646112 9:88413312-88413334 TAGGAGGCCAACACTTTAGGAGG - Intronic