ID: 914490088

View in Genome Browser
Species Human (GRCh38)
Location 1:148146363-148146385
Sequence CGCCCGGGCCGGGCCTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490088_914490094 -6 Left 914490088 1:148146363-148146385 CCGGTGGAGGCCCGGCCCGGGCG No data
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490088_914490095 -5 Left 914490088 1:148146363-148146385 CCGGTGGAGGCCCGGCCCGGGCG No data
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490088 Original CRISPR CGCCCGGGCCGGGCCTCCAC CGG (reversed) Intronic
No off target data available for this crispr