ID: 914490094

View in Genome Browser
Species Human (GRCh38)
Location 1:148146380-148146402
Sequence CGGGCGGCGCCCGCCATGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 3, 1: 2, 2: 1, 3: 4, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490088_914490094 -6 Left 914490088 1:148146363-148146385 CCGGTGGAGGCCCGGCCCGGGCG No data
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490072_914490094 29 Left 914490072 1:148146328-148146350 CCGGGCCAGGCCGGGCGGCGTTG No data
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490078_914490094 19 Left 914490078 1:148146338-148146360 CCGGGCGGCGTTGTTGGCGGGGG 0: 5
1: 1
2: 1
3: 3
4: 107
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490087_914490094 -5 Left 914490087 1:148146362-148146384 CCCGGTGGAGGCCCGGCCCGGGC No data
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490074_914490094 24 Left 914490074 1:148146333-148146355 CCAGGCCGGGCGGCGTTGTTGGC 0: 5
1: 1
2: 0
3: 4
4: 104
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40
914490085_914490094 -4 Left 914490085 1:148146361-148146383 CCCCGGTGGAGGCCCGGCCCGGG 0: 3
1: 2
2: 4
3: 19
4: 229
Right 914490094 1:148146380-148146402 CGGGCGGCGCCCGCCATGAACGG 0: 3
1: 2
2: 1
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490094 Original CRISPR CGGGCGGCGCCCGCCATGAA CGG Intronic