ID: 914490095

View in Genome Browser
Species Human (GRCh38)
Location 1:148146381-148146403
Sequence GGGCGGCGCCCGCCATGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 2, 1: 3, 2: 1, 3: 4, 4: 35}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490074_914490095 25 Left 914490074 1:148146333-148146355 CCAGGCCGGGCGGCGTTGTTGGC 0: 5
1: 1
2: 0
3: 4
4: 104
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35
914490088_914490095 -5 Left 914490088 1:148146363-148146385 CCGGTGGAGGCCCGGCCCGGGCG No data
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35
914490087_914490095 -4 Left 914490087 1:148146362-148146384 CCCGGTGGAGGCCCGGCCCGGGC No data
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35
914490085_914490095 -3 Left 914490085 1:148146361-148146383 CCCCGGTGGAGGCCCGGCCCGGG 0: 3
1: 2
2: 4
3: 19
4: 229
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35
914490078_914490095 20 Left 914490078 1:148146338-148146360 CCGGGCGGCGTTGTTGGCGGGGG 0: 5
1: 1
2: 1
3: 3
4: 107
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35
914490072_914490095 30 Left 914490072 1:148146328-148146350 CCGGGCCAGGCCGGGCGGCGTTG No data
Right 914490095 1:148146381-148146403 GGGCGGCGCCCGCCATGAACGGG 0: 2
1: 3
2: 1
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490095 Original CRISPR GGGCGGCGCCCGCCATGAAC GGG Intronic