ID: 914490207

View in Genome Browser
Species Human (GRCh38)
Location 1:148146885-148146907
Sequence CTGCCAGGTGGCGTCGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 5, 2: 7, 3: 2, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490207_914490221 23 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490221 1:148146931-148146953 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
914490207_914490220 10 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490220 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 2
2: 4
3: 19
4: 240
914490207_914490216 7 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490216 1:148146915-148146937 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
914490207_914490211 -8 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
914490207_914490223 24 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490223 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
914490207_914490217 8 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490207_914490218 9 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490218 1:148146917-148146939 ACCAGGTGAGGGCGACCCTGGGG 0: 5
1: 2
2: 2
3: 22
4: 159
914490207_914490212 -3 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490212 1:148146905-148146927 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228
914490207_914490213 -2 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490213 1:148146906-148146928 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490207 Original CRISPR CTGCCAGGTGGCGTCGATGT CGG (reversed) Intronic