ID: 914490209

View in Genome Browser
Species Human (GRCh38)
Location 1:148146897-148146919
Sequence GGTGCGCAGGGCCTGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 10, 1: 2, 2: 3, 3: 33, 4: 324}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490209_914490225 25 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490225 1:148146945-148146967 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
914490209_914490227 27 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490209_914490226 26 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490226 1:148146946-148146968 CAGCCTGGGCACACCCAAGAGGG No data
914490209_914490217 -4 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490209_914490218 -3 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490218 1:148146917-148146939 ACCAGGTGAGGGCGACCCTGGGG 0: 5
1: 2
2: 2
3: 22
4: 159
914490209_914490221 11 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490221 1:148146931-148146953 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
914490209_914490220 -2 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490220 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 2
2: 4
3: 19
4: 240
914490209_914490216 -5 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490216 1:148146915-148146937 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
914490209_914490223 12 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490223 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490209 Original CRISPR GGTGCGCAGGGCCTGCCAGG TGG (reversed) Intronic