ID: 914490211

View in Genome Browser
Species Human (GRCh38)
Location 1:148146900-148146922
Sequence CCTGGCAGGCCCTGCGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 10, 1: 2, 2: 2, 3: 28, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490204_914490211 10 Left 914490204 1:148146867-148146889 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
914490203_914490211 14 Left 914490203 1:148146863-148146885 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
914490201_914490211 28 Left 914490201 1:148146849-148146871 CCAGCTCGGGCAGGCCTTCCGAG 0: 3
1: 8
2: 0
3: 7
4: 80
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
914490205_914490211 0 Left 914490205 1:148146877-148146899 CCTCTATGCCGACATCGACGCCA 0: 1
1: 5
2: 2
3: 4
4: 13
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
914490207_914490211 -8 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490211 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490211 Original CRISPR CCTGGCAGGCCCTGCGCACC AGG Intronic