ID: 914490212

View in Genome Browser
Species Human (GRCh38)
Location 1:148146905-148146927
Sequence CAGGCCCTGCGCACCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 11, 1: 0, 2: 4, 3: 14, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490203_914490212 19 Left 914490203 1:148146863-148146885 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 914490212 1:148146905-148146927 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228
914490205_914490212 5 Left 914490205 1:148146877-148146899 CCTCTATGCCGACATCGACGCCA 0: 1
1: 5
2: 2
3: 4
4: 13
Right 914490212 1:148146905-148146927 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228
914490204_914490212 15 Left 914490204 1:148146867-148146889 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 914490212 1:148146905-148146927 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228
914490207_914490212 -3 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490212 1:148146905-148146927 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490212 Original CRISPR CAGGCCCTGCGCACCAGGTG AGG Intronic