ID: 914490213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:148146906-148146928 |
Sequence | AGGCCCTGCGCACCAGGTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 193 | |||
Summary | {0: 11, 1: 0, 2: 1, 3: 14, 4: 167} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
914490205_914490213 | 6 | Left | 914490205 | 1:148146877-148146899 | CCTCTATGCCGACATCGACGCCA | 0: 1 1: 5 2: 2 3: 4 4: 13 |
||
Right | 914490213 | 1:148146906-148146928 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
914490207_914490213 | -2 | Left | 914490207 | 1:148146885-148146907 | CCGACATCGACGCCACCTGGCAG | 0: 1 1: 5 2: 7 3: 2 4: 87 |
||
Right | 914490213 | 1:148146906-148146928 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
914490204_914490213 | 16 | Left | 914490204 | 1:148146867-148146889 | CCGAGAGGAACCTCTATGCCGAC | 0: 5 1: 1 2: 6 3: 9 4: 55 |
||
Right | 914490213 | 1:148146906-148146928 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
914490203_914490213 | 20 | Left | 914490203 | 1:148146863-148146885 | CCTTCCGAGAGGAACCTCTATGC | 0: 5 1: 1 2: 6 3: 4 4: 68 |
||
Right | 914490213 | 1:148146906-148146928 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
914490213 | Original CRISPR | AGGCCCTGCGCACCAGGTGA GGG | Intronic | ||