ID: 914490214

View in Genome Browser
Species Human (GRCh38)
Location 1:148146909-148146931
Sequence TCGCCCTCACCTGGTGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 10, 1: 1, 2: 0, 3: 6, 4: 90}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490214_914490227 15 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490214_914490225 13 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490225 1:148146945-148146967 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
914490214_914490231 25 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490214_914490232 26 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490232 1:148146958-148146980 ACCCAAGAGGGGACCAGGCGGGG 0: 2
1: 2
2: 9
3: 20
4: 204
914490214_914490223 0 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490223 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
914490214_914490234 27 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490234 1:148146959-148146981 CCCAAGAGGGGACCAGGCGGGGG 0: 2
1: 2
2: 8
3: 15
4: 191
914490214_914490226 14 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490226 1:148146946-148146968 CAGCCTGGGCACACCCAAGAGGG No data
914490214_914490236 28 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490236 1:148146960-148146982 CCAAGAGGGGACCAGGCGGGGGG 0: 2
1: 2
2: 6
3: 25
4: 252
914490214_914490229 21 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490229 1:148146953-148146975 GGCACACCCAAGAGGGGACCAGG 0: 4
1: 4
2: 2
3: 13
4: 152
914490214_914490230 24 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490230 1:148146956-148146978 ACACCCAAGAGGGGACCAGGCGG 0: 2
1: 0
2: 1
3: 17
4: 204
914490214_914490221 -1 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490221 1:148146931-148146953 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490214 Original CRISPR TCGCCCTCACCTGGTGCGCA GGG (reversed) Intronic