ID: 914490217

View in Genome Browser
Species Human (GRCh38)
Location 1:148146916-148146938
Sequence CACCAGGTGAGGGCGACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 5, 1: 6, 2: 2, 3: 15, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490203_914490217 30 Left 914490203 1:148146863-148146885 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490205_914490217 16 Left 914490205 1:148146877-148146899 CCTCTATGCCGACATCGACGCCA 0: 1
1: 5
2: 2
3: 4
4: 13
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490210_914490217 -7 Left 914490210 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490204_914490217 26 Left 914490204 1:148146867-148146889 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490207_914490217 8 Left 914490207 1:148146885-148146907 CCGACATCGACGCCACCTGGCAG 0: 1
1: 5
2: 7
3: 2
4: 87
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
914490209_914490217 -4 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490217 1:148146916-148146938 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490217 Original CRISPR CACCAGGTGAGGGCGACCCT GGG Intronic