ID: 914490219

View in Genome Browser
Species Human (GRCh38)
Location 1:148146918-148146940
Sequence CCCCCAGGGTCGCCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490219_914490226 5 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490226 1:148146946-148146968 CAGCCTGGGCACACCCAAGAGGG No data
914490219_914490234 18 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490234 1:148146959-148146981 CCCAAGAGGGGACCAGGCGGGGG 0: 2
1: 2
2: 8
3: 15
4: 191
914490219_914490227 6 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490219_914490236 19 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490236 1:148146960-148146982 CCAAGAGGGGACCAGGCGGGGGG 0: 2
1: 2
2: 6
3: 25
4: 252
914490219_914490221 -10 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490221 1:148146931-148146953 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
914490219_914490225 4 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490225 1:148146945-148146967 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
914490219_914490237 23 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490237 1:148146964-148146986 GAGGGGACCAGGCGGGGGGCCGG 0: 2
1: 4
2: 9
3: 90
4: 864
914490219_914490232 17 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490232 1:148146958-148146980 ACCCAAGAGGGGACCAGGCGGGG 0: 2
1: 2
2: 9
3: 20
4: 204
914490219_914490230 15 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490230 1:148146956-148146978 ACACCCAAGAGGGGACCAGGCGG 0: 2
1: 0
2: 1
3: 17
4: 204
914490219_914490238 24 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490238 1:148146965-148146987 AGGGGACCAGGCGGGGGGCCGGG 0: 2
1: 7
2: 4
3: 61
4: 632
914490219_914490241 27 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490241 1:148146968-148146990 GGACCAGGCGGGGGGCCGGGGGG 0: 2
1: 3
2: 8
3: 172
4: 4268
914490219_914490240 26 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490240 1:148146967-148146989 GGGACCAGGCGGGGGGCCGGGGG 0: 2
1: 3
2: 13
3: 64
4: 736
914490219_914490243 30 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490243 1:148146971-148146993 CCAGGCGGGGGGCCGGGGGGCGG 0: 2
1: 2
2: 13
3: 196
4: 1919
914490219_914490223 -9 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490223 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
914490219_914490229 12 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490229 1:148146953-148146975 GGCACACCCAAGAGGGGACCAGG 0: 4
1: 4
2: 2
3: 13
4: 152
914490219_914490231 16 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490219_914490239 25 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490239 1:148146966-148146988 GGGGACCAGGCGGGGGGCCGGGG 0: 2
1: 3
2: 10
3: 64
4: 828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490219 Original CRISPR CCCCCAGGGTCGCCCTCACC TGG (reversed) Intronic