ID: 914490227

View in Genome Browser
Species Human (GRCh38)
Location 1:148146947-148146969
Sequence AGCCTGGGCACACCCAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 6, 1: 4, 2: 1, 3: 14, 4: 243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490214_914490227 15 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490219_914490227 6 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490222_914490227 -8 Left 914490222 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490210_914490227 24 Left 914490210 1:148146900-148146922 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490224_914490227 -9 Left 914490224 1:148146933-148146955 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490209_914490227 27 Left 914490209 1:148146897-148146919 CCACCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
914490215_914490227 14 Left 914490215 1:148146910-148146932 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 914490227 1:148146947-148146969 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490227 Original CRISPR AGCCTGGGCACACCCAAGAG GGG Intronic