ID: 914490231

View in Genome Browser
Species Human (GRCh38)
Location 1:148146957-148146979
Sequence CACCCAAGAGGGGACCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 4, 1: 6, 2: 2, 3: 16, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914490214_914490231 25 Left 914490214 1:148146909-148146931 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490215_914490231 24 Left 914490215 1:148146910-148146932 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490219_914490231 16 Left 914490219 1:148146918-148146940 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490222_914490231 2 Left 914490222 1:148146932-148146954 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254
914490224_914490231 1 Left 914490224 1:148146933-148146955 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 914490231 1:148146957-148146979 CACCCAAGAGGGGACCAGGCGGG 0: 4
1: 6
2: 2
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914490231 Original CRISPR CACCCAAGAGGGGACCAGGC GGG Intronic