ID: 914496241

View in Genome Browser
Species Human (GRCh38)
Location 1:148200182-148200204
Sequence GAAATTTCCCCCTTTTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914496241_914496245 26 Left 914496241 1:148200182-148200204 CCCCTACAAAAGGGGGAAATTTC No data
Right 914496245 1:148200231-148200253 AATCATCTGGCATTATTTCCAGG No data
914496241_914496244 13 Left 914496241 1:148200182-148200204 CCCCTACAAAAGGGGGAAATTTC No data
Right 914496244 1:148200218-148200240 GTTTGAAATCTATAATCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914496241 Original CRISPR GAAATTTCCCCCTTTTGTAG GGG (reversed) Intergenic
No off target data available for this crispr