ID: 914497076

View in Genome Browser
Species Human (GRCh38)
Location 1:148208011-148208033
Sequence GGGGGTGTTTTGTTCAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914497070_914497076 25 Left 914497070 1:148207963-148207985 CCTAGAATGAAGGAGATGATAGT No data
Right 914497076 1:148208011-148208033 GGGGGTGTTTTGTTCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914497076 Original CRISPR GGGGGTGTTTTGTTCAATTC TGG Intergenic
No off target data available for this crispr