ID: 914498874

View in Genome Browser
Species Human (GRCh38)
Location 1:148225770-148225792
Sequence ACACCTTCATCTAGCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914498869_914498874 5 Left 914498869 1:148225742-148225764 CCCCACCATGGAAGAAAAAGCAT No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498868_914498874 6 Left 914498868 1:148225741-148225763 CCCCCACCATGGAAGAAAAAGCA No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498867_914498874 15 Left 914498867 1:148225732-148225754 CCAATGTTGCCCCCACCATGGAA No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498870_914498874 4 Left 914498870 1:148225743-148225765 CCCACCATGGAAGAAAAAGCATG No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498866_914498874 16 Left 914498866 1:148225731-148225753 CCCAATGTTGCCCCCACCATGGA No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498871_914498874 3 Left 914498871 1:148225744-148225766 CCACCATGGAAGAAAAAGCATGC No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data
914498872_914498874 0 Left 914498872 1:148225747-148225769 CCATGGAAGAAAAAGCATGCCAA No data
Right 914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914498874 Original CRISPR ACACCTTCATCTAGCCCTGA AGG Intergenic