ID: 914501104

View in Genome Browser
Species Human (GRCh38)
Location 1:148247160-148247182
Sequence AAAATGAAAAAAATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914501104_914501108 -3 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT No data
Right 914501108 1:148247180-148247202 TTTTAATAGGAGGCCTAGAGAGG No data
914501104_914501112 17 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT No data
Right 914501112 1:148247200-148247222 AGGTGTCCTATCCCCAGGATGGG No data
914501104_914501110 12 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT No data
Right 914501110 1:148247195-148247217 TAGAGAGGTGTCCTATCCCCAGG No data
914501104_914501111 16 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT No data
Right 914501111 1:148247199-148247221 GAGGTGTCCTATCCCCAGGATGG No data
914501104_914501113 22 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT No data
Right 914501113 1:148247205-148247227 TCCTATCCCCAGGATGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914501104 Original CRISPR AAAATGAAAAAAATGGAAGC TGG (reversed) Intergenic