ID: 914501113

View in Genome Browser
Species Human (GRCh38)
Location 1:148247205-148247227
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914501105_914501113 15 Left 914501105 1:148247167-148247189 CCATTTTTTTCATTTTTAATAGG No data
Right 914501113 1:148247205-148247227 TCCTATCCCCAGGATGGGCCTGG No data
914501104_914501113 22 Left 914501104 1:148247160-148247182 CCAGCTTCCATTTTTTTCATTTT 0: 2
1: 1
2: 8
3: 260
4: 2931
Right 914501113 1:148247205-148247227 TCCTATCCCCAGGATGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type