ID: 914506567

View in Genome Browser
Species Human (GRCh38)
Location 1:148295086-148295108
Sequence TGGATTGTGACAGCCAGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914506567_914506576 12 Left 914506567 1:148295086-148295108 CCCCCCCTGGCTGTCACAATCCA No data
Right 914506576 1:148295121-148295143 GTGAGGCAACCCCTGCGATATGG No data
914506567_914506574 -5 Left 914506567 1:148295086-148295108 CCCCCCCTGGCTGTCACAATCCA No data
Right 914506574 1:148295104-148295126 ATCCACATCGCAGGTGTGTGAGG No data
914506567_914506578 14 Left 914506567 1:148295086-148295108 CCCCCCCTGGCTGTCACAATCCA No data
Right 914506578 1:148295123-148295145 GAGGCAACCCCTGCGATATGGGG No data
914506567_914506582 23 Left 914506567 1:148295086-148295108 CCCCCCCTGGCTGTCACAATCCA No data
Right 914506582 1:148295132-148295154 CCTGCGATATGGGGAGTAATAGG No data
914506567_914506577 13 Left 914506567 1:148295086-148295108 CCCCCCCTGGCTGTCACAATCCA No data
Right 914506577 1:148295122-148295144 TGAGGCAACCCCTGCGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914506567 Original CRISPR TGGATTGTGACAGCCAGGGG GGG (reversed) Intergenic
No off target data available for this crispr