ID: 914507262

View in Genome Browser
Species Human (GRCh38)
Location 1:148300627-148300649
Sequence CTGCTGTTGTCAGACGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914507262_914507272 29 Left 914507262 1:148300627-148300649 CCAGGCCCGTCTGACAACAGCAG No data
Right 914507272 1:148300679-148300701 CCTTCCACAGAAAAATGTTGAGG No data
914507262_914507266 1 Left 914507262 1:148300627-148300649 CCAGGCCCGTCTGACAACAGCAG No data
Right 914507266 1:148300651-148300673 GTAAGGCAGAGTTCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914507262 Original CRISPR CTGCTGTTGTCAGACGGGCC TGG (reversed) Intergenic
No off target data available for this crispr