ID: 914511242

View in Genome Browser
Species Human (GRCh38)
Location 1:148334242-148334264
Sequence GAAATCCTACAAACTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914511238_914511242 -10 Left 914511238 1:148334229-148334251 CCCCGCTAGCACAGAAATCCTAC No data
Right 914511242 1:148334242-148334264 GAAATCCTACAAACTTCTGTGGG No data
914511237_914511242 17 Left 914511237 1:148334202-148334224 CCTGGCTCTAGGAGGTGAGAACA No data
Right 914511242 1:148334242-148334264 GAAATCCTACAAACTTCTGTGGG No data
914511234_914511242 30 Left 914511234 1:148334189-148334211 CCTAGAATTTCTACCTGGCTCTA No data
Right 914511242 1:148334242-148334264 GAAATCCTACAAACTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914511242 Original CRISPR GAAATCCTACAAACTTCTGT GGG Intergenic
No off target data available for this crispr