ID: 914513765

View in Genome Browser
Species Human (GRCh38)
Location 1:148356065-148356087
Sequence CTTTGGGGAAGAAGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914513765_914513776 25 Left 914513765 1:148356065-148356087 CCCCCTGCCCTTCTTCCCCAAAG No data
Right 914513776 1:148356113-148356135 GGTGCTCTCTCTGTACCCAGAGG No data
914513765_914513775 4 Left 914513765 1:148356065-148356087 CCCCCTGCCCTTCTTCCCCAAAG No data
Right 914513775 1:148356092-148356114 TCATAAGGCTCTCATGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914513765 Original CRISPR CTTTGGGGAAGAAGGGCAGG GGG (reversed) Intergenic
No off target data available for this crispr