ID: 914516150

View in Genome Browser
Species Human (GRCh38)
Location 1:148376384-148376406
Sequence AACAGAATCCTGCACCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914516150_914516153 -8 Left 914516150 1:148376384-148376406 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914516153 1:148376399-148376421 ATTCTGTTGGCTCCAATGATGGG No data
914516150_914516152 -9 Left 914516150 1:148376384-148376406 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914516152 1:148376398-148376420 GATTCTGTTGGCTCCAATGATGG No data
914516150_914516156 16 Left 914516150 1:148376384-148376406 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914516156 1:148376423-148376445 GTCAGATGGATTAATTTTTATGG No data
914516150_914516154 2 Left 914516150 1:148376384-148376406 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914516154 1:148376409-148376431 CTCCAATGATGGGTGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914516150 Original CRISPR AACAGAATCCTGCACCTAAC AGG (reversed) Intergenic
No off target data available for this crispr