ID: 914521943

View in Genome Browser
Species Human (GRCh38)
Location 1:148425582-148425604
Sequence GAAGCTGGTGGGAGTCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 1, 2: 2, 3: 57, 4: 494}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914521943_914521948 10 Left 914521943 1:148425582-148425604 CCGCCATGACTCCCACCAGCTTC 0: 1
1: 1
2: 2
3: 57
4: 494
Right 914521948 1:148425615-148425637 TGCCTTCCTCTTTGATGCACAGG No data
914521943_914521952 22 Left 914521943 1:148425582-148425604 CCGCCATGACTCCCACCAGCTTC 0: 1
1: 1
2: 2
3: 57
4: 494
Right 914521952 1:148425627-148425649 TGATGCACAGGAAGGCCCCTCGG No data
914521943_914521950 14 Left 914521943 1:148425582-148425604 CCGCCATGACTCCCACCAGCTTC 0: 1
1: 1
2: 2
3: 57
4: 494
Right 914521950 1:148425619-148425641 TTCCTCTTTGATGCACAGGAAGG No data
914521943_914521953 28 Left 914521943 1:148425582-148425604 CCGCCATGACTCCCACCAGCTTC 0: 1
1: 1
2: 2
3: 57
4: 494
Right 914521953 1:148425633-148425655 ACAGGAAGGCCCCTCGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914521943 Original CRISPR GAAGCTGGTGGGAGTCATGG CGG (reversed) Intergenic
900486253 1:2924206-2924228 CCAGCTGGTGGGAGGCTTGGGGG - Intergenic
900922938 1:5685185-5685207 GAAGGTGGTGGGGGTCGGGGTGG - Intergenic
901275834 1:7990297-7990319 GATGCTGGTGGTAATGATGGTGG - Intergenic
901434453 1:9238163-9238185 GGACCTGGTGGGGGACATGGGGG + Intronic
902273820 1:15325363-15325385 GAACCCAGTGGGAGACATGGGGG - Intronic
903140918 1:21338793-21338815 GCAGCTGGAGGGAGTCAGGCAGG + Intronic
903215611 1:21841953-21841975 CAAGCTGGGGGCAGGCATGGGGG - Intronic
903558765 1:24212283-24212305 GGAGGTGGTGTGAGTGATGGAGG + Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904887523 1:33752251-33752273 GGGCCTGGTGGGACTCATGGGGG + Intronic
905712307 1:40116615-40116637 GAAGCTGGGGGCAGTCTTGTGGG - Intergenic
906144758 1:43553412-43553434 GAGGAAGGTGGCAGTCATGGGGG - Intronic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
906682959 1:47743189-47743211 GATGGTGGTGGTAGTGATGGTGG + Intergenic
906804859 1:48770847-48770869 TAAGGTGGTGGTGGTCATGGTGG - Intronic
907193564 1:52668389-52668411 GACGCTGGAAGGAGTCAGGGAGG - Intronic
907807696 1:57837835-57837857 GGAGATGGTGGTAGTAATGGTGG - Intronic
907978241 1:59454638-59454660 TAATCTGGTGGGAGACAGGGAGG - Intronic
908366180 1:63425950-63425972 GATAGTGGTGAGAGTCATGGAGG + Intronic
908508282 1:64827923-64827945 GAAGCTGGCCTCAGTCATGGAGG - Intronic
909713451 1:78678518-78678540 GAAACTGCTGGGGGTGATGGGGG + Intergenic
910079920 1:83329444-83329466 GAAGCTGGTGGGTTTCATTTTGG - Intergenic
912500749 1:110120529-110120551 GATGGTGGTGGTAGTGATGGTGG - Intergenic
912809100 1:112780311-112780333 GAAGCAAGTGGGAGCCGTGGAGG + Intergenic
913287528 1:117240553-117240575 GATGCTGTTGGGGGTCAAGGTGG - Intergenic
914459703 1:147872103-147872125 GAACCTGGTGGGGGTCCTGAAGG - Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
915392658 1:155558606-155558628 GAAGCTGCTGTGAGCTATGGTGG - Intronic
917246137 1:173003368-173003390 GAGGCTGCTGTGAGTCATGATGG + Intergenic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917486415 1:175459051-175459073 GATGATGGTGGTGGTCATGGTGG - Intronic
919097998 1:193059847-193059869 GATGCGGGTGAGAGACATGGAGG - Intronic
919752151 1:201044357-201044379 GGAGCTGGAGAGAGCCATGGTGG - Exonic
919819720 1:201465559-201465581 GAAGGTGGTGGGGGTGAGGGGGG - Exonic
920092848 1:203466314-203466336 GAAGCTTGTGGGAGAAATGAGGG + Intergenic
920248517 1:204606229-204606251 GAAGGTGGTGGTGGTGATGGTGG + Intergenic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922500785 1:226095518-226095540 GGAGCTGGAGGGAGTCCTAGAGG + Intergenic
923203325 1:231733572-231733594 GGTGATGGTGGGAGTGATGGTGG + Intronic
923203338 1:231733641-231733663 GGTGATGGTGGGAGTGATGGTGG + Intronic
924419584 1:243895846-243895868 GATTCTGGTGGGAGACTTGGAGG - Intergenic
1062999875 10:1906339-1906361 GAAGATGGTGGGTGCCCTGGAGG + Intergenic
1062999889 10:1906440-1906462 GAAGATGGTGGGTGCCCTGGAGG + Intergenic
1063086923 10:2828261-2828283 TAAGCTTGTGGGAGAAATGGAGG + Intergenic
1063807786 10:9666948-9666970 GAATCTGGTGGGGCTCTTGGTGG + Intergenic
1064039854 10:11951820-11951842 GAAGCAGGTGACAGTGATGGGGG - Intronic
1064415839 10:15149284-15149306 GATGATGGTGGCAGTGATGGTGG - Intronic
1064415856 10:15149403-15149425 GATGATGGTGGCAGTGATGGTGG - Intronic
1065069926 10:22012972-22012994 GGAGCTGGTGGAAGTCAGCGTGG - Intergenic
1065721803 10:28634926-28634948 GAAGCTTGTGGGTTTCATGATGG - Intergenic
1066792312 10:39079327-39079349 GAAACTTTTGGGAGTCATTGAGG + Intergenic
1067173304 10:43925001-43925023 GCAGCAGGAGGGATTCATGGTGG - Intergenic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1070358419 10:75663210-75663232 GAAGCTGCTGGCAGACATAGGGG - Intronic
1071672573 10:87622801-87622823 GTGGCTGGTAGGAGTCATGCGGG + Intergenic
1073047776 10:100650977-100650999 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047782 10:100650995-100651017 GAAGGTGGTGGGAATAGTGGAGG - Intergenic
1073047792 10:100651031-100651053 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047798 10:100651049-100651071 GAAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047829 10:100651139-100651161 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047835 10:100651157-100651179 GAAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047841 10:100651175-100651197 GAAGGTGGTGGGAGTGGTGAAGG - Intergenic
1073047887 10:100651319-100651341 GAAGATGGTGGGAGTGGGGGTGG - Intergenic
1073047901 10:100651355-100651377 GAAGGTGGTGGGAATAGTGGAGG - Intergenic
1073047913 10:100651391-100651413 GAAGGTGGTGGGAATAGTGGAGG - Intergenic
1073047930 10:100651445-100651467 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047936 10:100651463-100651485 GAAGGTGGTGGGAATAGTGGAGG - Intergenic
1073047948 10:100651499-100651521 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047954 10:100651517-100651539 GAAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047973 10:100651571-100651593 CAAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073047983 10:100651607-100651629 GGAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073048003 10:100651664-100651686 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048020 10:100651709-100651731 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048037 10:100651754-100651776 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048054 10:100651799-100651821 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048071 10:100651844-100651866 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048088 10:100651889-100651911 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048105 10:100651934-100651956 GAAGGTGGTGGGAATCGTGGAGG - Intergenic
1073048122 10:100651979-100652001 GAAGGTGGTGGGAATAGTGGAGG - Intergenic
1073512373 10:104050824-104050846 TAAGCTGGAGGGAGGCCTGGGGG - Intronic
1074248207 10:111714907-111714929 GAACCTGGTGGGGCTCCTGGAGG - Intergenic
1074382033 10:112989065-112989087 GCAGCTGCTGGGAGTCTAGGTGG + Intronic
1075667936 10:124244231-124244253 GAAGATGGTGGAGGACATGGAGG - Intergenic
1075677543 10:124306161-124306183 GAAGATGGTGGTAGTGATGATGG - Intergenic
1076720929 10:132392653-132392675 GATGGTGGTGGTAGTGATGGGGG + Intergenic
1076730488 10:132436552-132436574 CTAGCTGGTGGGAGCCAAGGTGG + Intergenic
1077094370 11:793072-793094 GAGGATGGTGGGAGCCGTGGAGG + Intronic
1077226088 11:1439721-1439743 GAAGGTGGTGGGGGCCAGGGTGG - Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077288939 11:1780008-1780030 GTAGGGGGTGGGAGACATGGGGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077405033 11:2379001-2379023 GACGCTGGTGGGAGTCACTGTGG + Intronic
1077445708 11:2589685-2589707 GAAGTTGGCGGGAGGCATGGGGG - Intronic
1077811667 11:5644056-5644078 GATGTTGGTGGTGGTCATGGGGG - Exonic
1080052860 11:27874505-27874527 GAAACTGGTAGGAGTCAGGGAGG - Intergenic
1081575816 11:44317978-44318000 GAAGCTGGAGAGAGTCAAAGGGG + Intergenic
1082278577 11:50246686-50246708 GAAGCTGGAGGGAGTAGCGGTGG + Intergenic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083658959 11:64243303-64243325 GCTGCTGGGGTGAGTCATGGGGG + Exonic
1084002268 11:66302811-66302833 GAGGCCTGTCGGAGTCATGGGGG - Intergenic
1084596751 11:70121089-70121111 GAAGGTGGTGGGAGCCACTGAGG + Intronic
1085159396 11:74326897-74326919 GCAGCTGACGGGAGTCATCGAGG - Intergenic
1085238033 11:75030343-75030365 GAAGCTGGTGGGGGTGGGGGTGG + Intergenic
1085764439 11:79270746-79270768 GAGGCTGGGAGGAGTCATGGTGG - Intronic
1085773152 11:79342446-79342468 GAAGAGGGTGGGAGGGATGGTGG + Intronic
1088823761 11:113476789-113476811 GGAGCTGGGAAGAGTCATGGTGG - Intergenic
1089074304 11:115725880-115725902 GGAGATGGTGGCAGTGATGGTGG - Intergenic
1089128165 11:116191880-116191902 GGAGGGGGTGGGAGCCATGGAGG + Intergenic
1089268659 11:117285828-117285850 GAAGCTTGTGGGGTACATGGAGG - Exonic
1090836397 11:130457361-130457383 GCAGCTGGTGGGAATCGTGGTGG + Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1092100721 12:5881691-5881713 GGAGCTGGAGGGAGTGATGGGGG - Intronic
1092163853 12:6330549-6330571 GGAGCTGGTGGGGGTGAGGGAGG - Intronic
1093134203 12:15430516-15430538 AAAGATGGTGGTAGTCATGATGG + Intronic
1093186275 12:16022856-16022878 GAACCTGGTGGGGTTCTTGGAGG - Intronic
1095800265 12:46265161-46265183 GATGCTGGTGGTAGTGTTGGTGG - Intronic
1096280245 12:50246456-50246478 AAAGCTGTTGGGGGTCAAGGGGG - Intronic
1097572942 12:61356251-61356273 GAAGCTGGAGGGAGTGCTGAGGG - Intergenic
1098187766 12:67916327-67916349 CAAGCTGGTGGGAGTGGGGGTGG - Intergenic
1098237370 12:68430399-68430421 TTAGGTGGTGGGAGACATGGTGG + Intergenic
1101761144 12:107660085-107660107 GATGGGGGTGGGGGTCATGGAGG + Intergenic
1102144807 12:110646824-110646846 GAAACTGGTGGGAGGGATGGAGG - Intronic
1102205780 12:111089931-111089953 GAGGGTGATGGGAGCCATGGAGG + Intronic
1102231249 12:111264010-111264032 GAAGATGGGGGGAGCCCTGGGGG - Intronic
1102605284 12:114063799-114063821 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605372 12:114064087-114064109 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605391 12:114064160-114064182 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605400 12:114064196-114064218 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605410 12:114064232-114064254 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605420 12:114064268-114064290 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605439 12:114064340-114064362 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102834185 12:116038538-116038560 GGAGCAAGTGGCAGTCATGGTGG + Intronic
1103005600 12:117417928-117417950 GAAGCTGTTGGAAGTTTTGGGGG - Intronic
1103443113 12:120978335-120978357 GAAGGTGCTGGGAGCCAGGGAGG - Intergenic
1103857393 12:123982346-123982368 GAAGTTGGTGGCAGTCAGTGTGG + Intronic
1103883836 12:124186431-124186453 GCAGCCGTTGGGAGCCATGGAGG + Intronic
1104688577 12:130807051-130807073 GAAGTTTGTGGAAGCCATGGCGG - Exonic
1104823967 12:131695250-131695272 GGAGGTGGTGAGAGTCAGGGTGG - Intergenic
1107316098 13:39133735-39133757 GAAGCTGTGGTCAGTCATGGTGG - Intergenic
1107402395 13:40082202-40082224 GATGCTGGTGGTGGTGATGGTGG + Intergenic
1107663638 13:42665663-42665685 GAAGCAGGTTGAACTCATGGAGG - Intergenic
1107980182 13:45727651-45727673 GAACATGGTGGGACTCCTGGAGG + Intergenic
1108121595 13:47193801-47193823 GAACCTGGTGGAACTCCTGGAGG + Intergenic
1113086758 13:106576734-106576756 GAACCTGGTGGGGTTCCTGGAGG + Intergenic
1113199166 13:107846249-107846271 GAACATGGTGGGTTTCATGGCGG - Intronic
1113612188 13:111654956-111654978 GATGCTGGTGGGAATAATGAGGG + Intronic
1115368843 14:32589273-32589295 TAAACTGGTGGGAATCAAGGGGG - Intronic
1117499665 14:56339408-56339430 AAAACTGGTGGGAGGCAGGGAGG - Intergenic
1117906221 14:60591280-60591302 GAATCTGGTGGAATTCCTGGAGG + Intergenic
1118008952 14:61590493-61590515 GAGGCTGGTGGGGTTCCTGGTGG - Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1119556125 14:75554330-75554352 GAAGTTGGTTGGAGTCTTGTGGG - Intergenic
1120817052 14:88872138-88872160 GAAGTTTCTGGGAGTCATTGCGG + Intronic
1121730277 14:96182017-96182039 GAAGCTGGGGGGAGACCTGGGGG - Intergenic
1122327431 14:100891050-100891072 GAGGCTGGTGAGATTCCTGGGGG + Intergenic
1122581596 14:102775286-102775308 GAAGCTGCTGTGAGCCATGATGG - Intergenic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1123106751 14:105845321-105845343 GAAGGTGCTGGGGGTCCTGGGGG + Intergenic
1123857350 15:24426939-24426961 GCAGGTGGTGGGATCCATGGAGG + Intergenic
1123988395 15:25665256-25665278 GAAGAGGGTGGCAGGCATGGAGG + Intergenic
1124368843 15:29091870-29091892 GATGCTGGAGGGACTCAGGGAGG + Intronic
1125008594 15:34845968-34845990 GAGGCTGCTGTGAGCCATGGTGG - Intergenic
1125218973 15:37311304-37311326 GAACCTGGTGGGGATCTTGGAGG - Intergenic
1125504670 15:40260202-40260224 AAAGCTGGTGGGAGTGACGGCGG - Intronic
1125729226 15:41883407-41883429 GAAGCAGGTGGCAGACATGCAGG - Exonic
1126664909 15:51067396-51067418 GCAGCTTGTGGGACTCATGGGGG + Intronic
1128369816 15:67032488-67032510 GAACCTGGTGGTAGTGATGGAGG - Intergenic
1129701586 15:77771597-77771619 GAACTTGGTGGGGGTCTTGGAGG - Intronic
1130679089 15:85980841-85980863 CAAGCTGAGGGGAGTCAGGGCGG - Intergenic
1130790208 15:87146451-87146473 GAAACTAGTGGGAATCATGGTGG + Intergenic
1131402343 15:92135163-92135185 AAAGCTGGAGGGAGAGATGGAGG + Intronic
1131816341 15:96224867-96224889 GAAGATGGTGGCAGTGGTGGTGG - Intergenic
1132169464 15:99634232-99634254 GAAGTTGGTGGGAGAGATGAGGG + Intronic
1132396418 15:101478308-101478330 GTGGCTGGCGGCAGTCATGGTGG + Intronic
1132752747 16:1466302-1466324 GAAGGTGGAGGGAGAGATGGGGG - Intronic
1134359492 16:13518004-13518026 GCAGCTGCTGGCAGTCAAGGAGG + Intergenic
1134432527 16:14224188-14224210 GGGCCTGGTGGGAATCATGGGGG - Intronic
1136226356 16:28863259-28863281 GAAGATGGTGGTAGTGGTGGGGG - Intronic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1136477056 16:30520021-30520043 GGATCTGGTGGGAGCCAGGGAGG + Intronic
1137028272 16:35499525-35499547 GAAGGTGCTGGGAGTCAGGGAGG + Intergenic
1137308876 16:47233469-47233491 GAATCTGGTGGAATTCCTGGAGG - Intronic
1137337170 16:47561314-47561336 CAAGCCAGTGAGAGTCATGGTGG - Intronic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1138375538 16:56561270-56561292 GAATCAGGTGGCAGCCATGGAGG + Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1139194843 16:64906820-64906842 AAAGCTGGAGAGTGTCATGGAGG + Intergenic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139358294 16:66380517-66380539 GTAGGTGGTGGCAGTGATGGTGG + Intronic
1140199126 16:72880170-72880192 GAAGGTGGTGGGAGAGATGAAGG - Intronic
1140288004 16:73622737-73622759 AGAGCTGCTGGGAGTCATGAAGG - Intergenic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142527160 17:551500-551522 AAGGCTGCAGGGAGTCATGGTGG + Intronic
1142534076 17:601558-601580 GAAGCTTGTGTGTGTCCTGGAGG + Intronic
1143033755 17:3982662-3982684 GAGGCTGGGTGGAGGCATGGAGG - Intergenic
1143137564 17:4720293-4720315 GAGGCGGGTGAGTGTCATGGGGG + Exonic
1143781812 17:9233115-9233137 GAAGCTGCTGGGAGCCACTGGGG + Intronic
1143928793 17:10398583-10398605 GCAGCAGGTCGCAGTCATGGCGG + Exonic
1144077326 17:11731082-11731104 GATGATGGTGGGGGTGATGGTGG + Intronic
1144146424 17:12403778-12403800 GCAGCTGGTGGGAGTGTGGGGGG - Intergenic
1144457249 17:15429415-15429437 GATGGTGGTGGTGGTCATGGTGG + Intergenic
1144659243 17:17057738-17057760 GCAGCGGGTGGGGGTCAGGGTGG - Intronic
1145989500 17:29070430-29070452 GAAGATGGAAGGAGTCAGGGTGG + Intergenic
1146167043 17:30598297-30598319 GAAGGTGATGGGAGACCTGGGGG - Intergenic
1146981176 17:37163111-37163133 GAAGGTGTTGGGACTCTTGGTGG - Intronic
1147398451 17:40163683-40163705 GAAGCTGGTGGGCAGCATGGTGG + Exonic
1147576016 17:41599398-41599420 GATGGTGGTGGTGGTCATGGTGG + Intergenic
1148083867 17:44982524-44982546 AGAGCTGGTGGTAGTGATGGAGG + Intergenic
1148165114 17:45478114-45478136 GAAGCTGGTGGGATCCGTGAAGG - Exonic
1148291971 17:46460140-46460162 CAGGCTAGTGGGAGTAATGGGGG + Intergenic
1148314161 17:46677831-46677853 CAGGCTAGTGGGAGTAATGGGGG + Intronic
1148713709 17:49700427-49700449 GATGCTGGCGGAAGTCATGGTGG - Intergenic
1148835876 17:50465470-50465492 GAAGAAGGTGGGAGTGCTGGGGG + Intronic
1149456542 17:56792890-56792912 GATGGTGGTGGGGGTGATGGTGG + Intronic
1149754740 17:59177440-59177462 GAAGCTGGAGGAAGGCATGTTGG + Intronic
1150148791 17:62792979-62793001 GGAGGTGGTGGTAGTGATGGAGG - Intronic
1150164590 17:62929336-62929358 GGAGCAGTTGGGGGTCATGGAGG + Intergenic
1150267751 17:63842233-63842255 GAAGCAGCTGGGAGGCCTGGGGG - Intronic
1150649609 17:67001321-67001343 GGAGCTGGAGGGAGCCATGTGGG - Intronic
1151164107 17:72189442-72189464 GATGATGGTGGTAGTGATGGTGG + Intergenic
1151190688 17:72395700-72395722 GAAGCAGGATGGAGTCATGGTGG - Intergenic
1152017431 17:77761014-77761036 GAAGCTGGCGGCACCCATGGAGG + Intergenic
1152057586 17:78042748-78042770 GATGCTGGTGGTGATCATGGTGG + Intronic
1152187103 17:78864358-78864380 GAAGGGGGAGGGAGGCATGGAGG - Intronic
1152273451 17:79339511-79339533 GGAGCTGGTGGGAGGGAAGGAGG + Intronic
1152404969 17:80092452-80092474 GAGACTGGTGGCTGTCATGGCGG - Intronic
1153144920 18:2020224-2020246 GAACCTGGTAGGGATCATGGAGG + Intergenic
1153759843 18:8319964-8319986 GCAGATGGTGGGGGTCATGAGGG + Intronic
1153904220 18:9646748-9646770 GAAGCTGCTGGGAATAAGGGGGG + Intergenic
1154274518 18:12947853-12947875 GAAGGTGGGGCGAGTCATGACGG + Intronic
1158503141 18:58021817-58021839 GAAGGTGGTGGGAGTGAAGCTGG + Intergenic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161286481 19:3471107-3471129 GAAGGAGGTGGGAGCCATGGAGG + Intergenic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161482976 19:4519889-4519911 GGAGAAGGTGGGAGCCATGGAGG - Intergenic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161508583 19:4657790-4657812 GAAGCTGTTGGGAGCCAGGAGGG + Exonic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161783059 19:6306466-6306488 GAGGATGGGGGGGGTCATGGAGG + Exonic
1162185196 19:8899356-8899378 GATGCTTGTGGTGGTCATGGTGG - Intronic
1162194508 19:8973951-8973973 GATGCTAGTGGGACTGATGGAGG + Exonic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162534088 19:11253057-11253079 GAGGGCGGTGGGAGCCATGGAGG + Intronic
1162622617 19:11855947-11855969 GAAACTGGAGGGACCCATGGTGG - Intronic
1162819340 19:13213079-13213101 CAAGCAAGTGGGAGCCATGGAGG - Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162998078 19:14348982-14349004 GAGGCTGCTGTGAGTCATGATGG + Intergenic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163406440 19:17126021-17126043 GAAGGGGGTGGGTGTCATGGAGG - Intronic
1163533006 19:17861693-17861715 GGAGCGGGTGGGTGGCATGGTGG + Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165252494 19:34551649-34551671 GAATCTGGTGGGTCTCCTGGAGG + Intergenic
1166882905 19:45940075-45940097 GAACCTGGTGGGAGCCATCCTGG - Exonic
1167571371 19:50290955-50290977 GAAGCTGGAGGGAGAGCTGGAGG + Exonic
1167603238 19:50466534-50466556 GAAGCTGCTGGGAGGGAGGGAGG + Intergenic
1167646205 19:50706492-50706514 GAAGTTGGTGAGGGTCAGGGTGG - Intronic
925856452 2:8134073-8134095 GAAGCTGGCGGGAGGCAGGAGGG - Intergenic
926022429 2:9508303-9508325 GAAGCTGGTGAGGGGCACGGGGG - Intronic
926194429 2:10754002-10754024 GAGCGTGGTGGAAGTCATGGAGG + Exonic
926326779 2:11791960-11791982 GAAGATGGTGGTTTTCATGGAGG + Exonic
926634341 2:15164274-15164296 GAACCTGGTGGGCATCCTGGAGG - Intergenic
926962376 2:18372408-18372430 GAACCTGGTGGGTGTTCTGGTGG - Intergenic
927290392 2:21399383-21399405 GAAGCAGAGGTGAGTCATGGTGG + Intergenic
927853118 2:26512156-26512178 GAAGGAGGTGGGGGTCGTGGAGG + Intronic
927886256 2:26720703-26720725 GAAGCTGCTGGGGGTAGTGGGGG + Intronic
929277971 2:40045744-40045766 GTAGCTGGAGGGAGAAATGGAGG - Intergenic
929791225 2:45024482-45024504 GGAGCTGGTTGGTGTCAGGGAGG + Intergenic
930909246 2:56610890-56610912 GAAGCTAGTGGGATTCCTGAAGG + Intergenic
931220424 2:60284098-60284120 GAAGCGGGTGGGTTTCTTGGTGG + Intergenic
932073943 2:68645856-68645878 GAAGCTGGTGGAAGTGTTGGTGG - Exonic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
935856739 2:107282576-107282598 GAATCTGGTGGGGCTCCTGGAGG + Intergenic
937478432 2:122235933-122235955 GTGTCTGGTGGGTGTCATGGAGG + Intergenic
938191178 2:129282153-129282175 TAAGTTGGAGTGAGTCATGGAGG - Intergenic
938229771 2:129648477-129648499 GAAGCAGCCTGGAGTCATGGTGG - Intergenic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
943855720 2:192787809-192787831 GAACCTGGAGGGATTCCTGGAGG - Intergenic
944469896 2:200041737-200041759 GAAGCTGGCAGGAGACCTGGAGG - Intergenic
945072386 2:206004626-206004648 GGAGCTGCTGGGGGTCACGGTGG + Exonic
945722044 2:213429347-213429369 GAAGGTGGTGGGGGTCAAGTTGG - Intronic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947831318 2:233143877-233143899 GGAGATGGTGGTAGTGATGGTGG + Intronic
947831510 2:233144753-233144775 GGAGATGGTGGTAGTGATGGTGG + Intronic
948229201 2:236337305-236337327 GAAGCTGGGGAGAGTGCTGGCGG - Intronic
948352298 2:237350933-237350955 GATGGTGGTGGGAATTATGGTGG + Intronic
948463809 2:238142819-238142841 GAAGCTGGAGGAGGTCCTGGTGG + Exonic
948804723 2:240448543-240448565 GAAATGGGTGGGAGTCACGGAGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1168847463 20:955180-955202 GGTGAGGGTGGGAGTCATGGGGG + Intergenic
1168892729 20:1305451-1305473 GAAGCTGCTGTGTGGCATGGAGG + Exonic
1171002636 20:21430130-21430152 GAACCTGGTGGGGTTCCTGGAGG + Intergenic
1171267461 20:23783389-23783411 GATGCTGGTGATAGTGATGGTGG - Intergenic
1171280320 20:23890701-23890723 GATGCTGGTGATAGTGATGGTGG - Intergenic
1172077563 20:32310930-32310952 GAAGGTGGTGGCAGTGGTGGGGG + Exonic
1172764081 20:37341810-37341832 GGAGGTGGTGGGAGCCACGGAGG - Intergenic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1173177099 20:40772694-40772716 GAAGATGGTGGTGGTGATGGTGG - Intergenic
1173680251 20:44874338-44874360 GAAACTGGTGGGACTCTGGGAGG - Intergenic
1174381795 20:50160462-50160484 GAATCTGCTGGCAGCCATGGGGG + Intergenic
1174429694 20:50458906-50458928 GAAGCTGCTGTGAGTCATGATGG + Intergenic
1174446777 20:50596045-50596067 GAAGGTGGTGGGAAGCATGAAGG - Intronic
1175009276 20:55718551-55718573 CCAGCTGCTGGGAGTGATGGTGG - Intergenic
1175319271 20:58073867-58073889 GATACTGGTTGGAGTCATGCAGG - Intergenic
1176022748 20:62970508-62970530 GAAGCTGCTGGGAGGGAAGGGGG - Intergenic
1176304012 21:5114106-5114128 GAAGCAGCTGGGAGTGGTGGGGG + Intergenic
1176454728 21:6898557-6898579 GAAGCTGCTGGCGCTCATGGGGG - Intergenic
1176675193 21:9771060-9771082 GAAGCTCATGGGTGTGATGGTGG - Intergenic
1177228913 21:18293606-18293628 GAAGGGGGTGGGAGTAAAGGAGG - Intronic
1177556196 21:22691834-22691856 GCATCTGGTCTGAGTCATGGTGG - Intergenic
1177746779 21:25224723-25224745 GAAGATGGTTGGATTCATGTGGG - Intergenic
1178505655 21:33160852-33160874 GATGGTGGTGGTGGTCATGGAGG + Intergenic
1178960980 21:37064686-37064708 CAAGCTGTTGGGAGTCTTGAAGG - Exonic
1179046311 21:37848197-37848219 GAAGATGGTGGGAGATGTGGAGG + Intronic
1179176343 21:39010766-39010788 GGAGCTGGAGGGAGGCCTGGGGG - Intergenic
1179305304 21:40148736-40148758 GAAGCTGGTGGTGATGATGGTGG - Intronic
1179418848 21:41219969-41219991 GAAGCTGGGGGCAGTCTTGGGGG - Intronic
1179500654 21:41806528-41806550 GATGTTGGTGGTAGTGATGGTGG - Intronic
1179500667 21:41806590-41806612 GATGGTGGTGGTAGTAATGGTGG - Intronic
1179710983 21:43262787-43262809 GAAGGTGGTGGTGGTGATGGTGG + Intergenic
1179831284 21:43998275-43998297 GAATCTGCTGGGAGTCAAGAGGG - Intergenic
1179853018 21:44147844-44147866 GAAGCAGCTGGGAGTGGTGGGGG - Intergenic
1180901307 22:19375414-19375436 GTGGCTGGAAGGAGTCATGGGGG - Intronic
1181034203 22:20162150-20162172 GATGGTGGTGGTAGTCATGGTGG - Intergenic
1181194117 22:21169614-21169636 GAAGCTAGTGGCAGTCCTGCTGG + Intergenic
1181215325 22:21323164-21323186 GAAGCTAGTGGCAGTCCTGCTGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181862536 22:25829990-25830012 GAAGAAGGTGGGAGTCATATGGG - Intronic
1182282345 22:29224862-29224884 GAGGCTGGTTGGGGTCATTGGGG + Intronic
1182860573 22:33556083-33556105 GAAGTTGGAGGGAGTCAGGAGGG - Intronic
1182897617 22:33872042-33872064 GCAGGAGGTGGGAGTGATGGAGG + Intronic
1183244070 22:36680141-36680163 GATGGTGGTGGTAGTGATGGTGG - Intronic
1183244079 22:36680183-36680205 GATGGTGGTGGTAGTGATGGTGG - Intronic
1183244115 22:36680393-36680415 GATGATGGTGGTAGTGATGGTGG - Intronic
1183310593 22:37107492-37107514 GATGATGGTGGGAGTCATGGGGG - Intronic
1183478543 22:38050481-38050503 AAAGCTGGTGGGAGCCCAGGGGG - Intergenic
1183638930 22:39081764-39081786 AAAGCAGGTGGGAGGCAGGGAGG - Intronic
1183923941 22:41192114-41192136 GAAACTGTTGGGAGTTGTGGTGG + Intergenic
1183981048 22:41540446-41540468 GAGGGTGGTGGGAGTCCTGGAGG - Intronic
1184290302 22:43495322-43495344 GATGGTGGTGGTAGTGATGGAGG + Intronic
1184290313 22:43495379-43495401 GATGGTGGTGGTAGTGATGGAGG + Intronic
1184291545 22:43500204-43500226 GGAGGTGGTGGGGGTGATGGTGG + Intronic
1184417526 22:44360939-44360961 GAAGCTGGTGGGATTCCTGGGGG - Intergenic
1185100641 22:48839204-48839226 GATGCTGCTGGGGGTCATGCAGG - Intronic
1185114233 22:48922303-48922325 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
949530238 3:4948178-4948200 GAAGCTGCAGTGAGCCATGGTGG - Intergenic
950103968 3:10376815-10376837 GAAGACAGTGGGAGTCACGGAGG + Intronic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
952971258 3:38651598-38651620 GAAGCTGCTGGGAGTAGGGGTGG + Intergenic
953783734 3:45894929-45894951 GAAGTCTGTGGGTGTCATGGTGG - Exonic
953984520 3:47431104-47431126 GAAGCTGCTGGGAGGCACAGAGG + Intronic
954460894 3:50626282-50626304 GGAGCTGGTGGGAGTCTGGGAGG + Intronic
954665473 3:52249119-52249141 GAGGCTGGTGGGAGTCGGGAAGG + Intronic
955398757 3:58576152-58576174 GAAGCTGCTGGGAGATCTGGAGG - Intronic
957733097 3:84168169-84168191 GCAGCTTGTGGGAGCCAGGGTGG - Intergenic
957882825 3:86243523-86243545 AAAGCTGGTGAGAGTCATAAGGG + Intergenic
958170628 3:89935176-89935198 GAAGCTGTAGTGAGTCATGATGG - Intergenic
959295555 3:104530684-104530706 GAAGCTGTTGGGAGCCAGGAAGG - Intergenic
961130056 3:124457781-124457803 GAAGCTGGTGAGAGACATAATGG - Intronic
961366934 3:126406232-126406254 GAAGATGGCGGGAGTCTTGTGGG - Intronic
961381780 3:126500229-126500251 GAAGTTGGTGGGGAGCATGGCGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961640321 3:128360876-128360898 GAAGGTGGTGGGTGGGATGGAGG - Intronic
962072731 3:132048551-132048573 GAGGCTGCAGGGAGTCATGATGG - Intronic
962158157 3:132970822-132970844 GAAGCTGGTGGGGGTAGAGGTGG - Intergenic
962351102 3:134656287-134656309 GGAGCTGGAAGGAGTGATGGAGG + Intronic
962578758 3:136778404-136778426 GATGCTGGTGGGAGTCCTCATGG - Intergenic
962706595 3:138050509-138050531 GGAGGTGGTGGTAGTGATGGTGG + Intergenic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
963108665 3:141666807-141666829 GAAACTGGTAGGATTCTTGGTGG - Intergenic
964094257 3:152913075-152913097 GAAGCTGGTGGATGTCAGGCAGG + Intergenic
964883009 3:161445451-161445473 GAAGCAGTTGGAAGTCTTGGAGG - Intergenic
965457800 3:168925496-168925518 GAAGAAGGTGGGAGTCAGGTGGG + Intergenic
966853571 3:184178925-184178947 GAAGCTGGTGCGAGCAATGTTGG - Exonic
967117574 3:186355564-186355586 GATGGTGGTGGGGGTAATGGTGG - Intronic
967460899 3:189744570-189744592 TAAGTTGGTGGCAGTTATGGTGG - Intronic
968645860 4:1740174-1740196 GAAGCTGGTGGTAGTGAGGCTGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969121352 4:4913728-4913750 GAAGCTGCTGGGAACCCTGGAGG + Intergenic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969418562 4:7076604-7076626 GACGGTGGTGGGAGTGGTGGCGG + Intergenic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
972000715 4:34029000-34029022 GAACCTGGTGGGGATCCTGGAGG - Intergenic
972421253 4:38888750-38888772 GAAGGAGGTGGGAGTTATGGGGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974819285 4:67045742-67045764 GCAGGGGGTGGGGGTCATGGGGG - Intergenic
974907734 4:68078117-68078139 TAAGCAGGTGGGAGTAAGGGTGG - Intronic
976623789 4:87156397-87156419 GAGGCAGGTGGGGGTCGTGGGGG + Intergenic
977705513 4:100066316-100066338 GAAGATGGTGGAAGGCAAGGAGG + Intergenic
977853978 4:101865402-101865424 AAACCTGGTGGGATTCATGGAGG - Intronic
978062836 4:104359314-104359336 GAGGCTGGGGAGAGTAATGGTGG + Intergenic
978315441 4:107430733-107430755 GAAGGTGGAGGGAGTGAAGGAGG - Intergenic
982216957 4:153090900-153090922 GAGGCTGGTTGGTGCCATGGGGG - Intergenic
982546214 4:156736414-156736436 AAAGCTGCTGGGAGTCTTGGTGG + Intergenic
983354330 4:166636663-166636685 GAAACTGGTGGGACTCCTGGAGG + Intergenic
983422969 4:167544015-167544037 GAAGCTGGTGAGAGGCATGAGGG - Intergenic
984167153 4:176316213-176316235 GAACCTAGTGGCAGTAATGGGGG - Intergenic
985546328 5:511006-511028 GAGGCTGGAGGGAGTCGTGATGG - Intronic
985720656 5:1486955-1486977 GAAACTGAGGGGACTCATGGCGG - Intronic
986127236 5:4894413-4894435 GAAGCGGGTGGGAGTCATGGGGG + Intergenic
986145226 5:5071542-5071564 GAGGCTGGTGGGCCTCCTGGGGG + Intergenic
986311788 5:6556679-6556701 GCATCTGGTGGCATTCATGGGGG + Intergenic
986346133 5:6837126-6837148 GGAGCTGGCTGGAGTCAGGGAGG + Intergenic
986833237 5:11605742-11605764 AAATCTGGTGGTAGTGATGGAGG + Intronic
987035813 5:14017311-14017333 GTTGCTGGGGGCAGTCATGGAGG - Intergenic
987129831 5:14850181-14850203 GAAGCCGGTGGGAGTGGTGGGGG - Intronic
988384949 5:30551123-30551145 GAAGATGGTCAGAGTCATTGTGG - Intergenic
989378618 5:40791823-40791845 GAATCTGGGAGGAGTCATGCAGG - Intronic
991084612 5:62637052-62637074 GAAACTGGTGGGATTCCTAGAGG + Intergenic
991406908 5:66308888-66308910 GAAGCAGCTTGGTGTCATGGCGG - Intergenic
992884976 5:81149652-81149674 GAAGATGGTGAAACTCATGGAGG - Intronic
993547644 5:89231586-89231608 GAATCTGGTGGGATTCCTTGAGG + Intergenic
993892461 5:93490652-93490674 GATGGTGGTTGTAGTCATGGTGG + Intergenic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
994215081 5:97128879-97128901 GAGGCTGGTTGGAGTCAGGAGGG - Intronic
994932875 5:106211938-106211960 GAACCTGGTGGGGATCCTGGAGG - Intergenic
996058774 5:119009812-119009834 GAGGGTGGCGGGAGCCATGGGGG + Intergenic
997629287 5:135354564-135354586 GAAGCTGAAGGAAGCCATGGGGG + Intronic
998379747 5:141715787-141715809 GAAGCTGGTGGGAGGTGTGAGGG + Intergenic
998947572 5:147356487-147356509 GAAGCTGGAGACAGTCATAGGGG + Intronic
999112571 5:149134686-149134708 TAAGCTTGTATGAGTCATGGTGG - Intergenic
999407804 5:151322753-151322775 GAAGTTAGGGGGAGTCAGGGTGG + Intronic
999428575 5:151507216-151507238 GCAGCTGGCGGGAGTCTGGGGGG + Exonic
1000957988 5:167564690-167564712 CTAGCTGGTGGGTTTCATGGGGG + Intronic
1001286137 5:170425435-170425457 GCAGGTGATGGCAGTCATGGGGG + Intronic
1001578039 5:172777574-172777596 GAAGCTTGTGTGAGTCACGGAGG - Intergenic
1002047934 5:176552516-176552538 GCAGCCAGTGGGAGCCATGGAGG + Intronic
1002064692 5:176646228-176646250 GAGGGTGGGGTGAGTCATGGCGG + Exonic
1002161058 5:177314377-177314399 GGAGGTGGTGGGAGTCGGGGTGG + Intergenic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002912925 6:1504969-1504991 GAAGCTGGTGGGGAGCAAGGAGG + Intergenic
1003451941 6:6243178-6243200 GATGGTGGTGGGAGTGATGGTGG - Intronic
1003888314 6:10540828-10540850 AAAGTTGGTGGAAGTGATGGGGG - Intronic
1003926100 6:10879335-10879357 GTAGCTCGTGTGAGGCATGGGGG - Intronic
1004275717 6:14233523-14233545 GATGGTGGTGGTATTCATGGAGG + Intergenic
1004623843 6:17356082-17356104 GAGGCTGGAGTGAGCCATGGTGG + Intergenic
1005917465 6:30365796-30365818 AAAGGTTGTGGGAGTCATGTAGG - Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006236577 6:32638610-32638632 GAAGCTGCAGTGAGCCATGGTGG + Intronic
1006321883 6:33323986-33324008 GAGGCTGGAGGGACTCGTGGAGG + Intronic
1006494357 6:34410979-34411001 GAAGCTGCAGTGAGTCATGATGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006720529 6:36147353-36147375 GAAGGGGGTGGCAGGCATGGTGG - Intergenic
1007237767 6:40403354-40403376 GGAGCTGGTGGGATTCAGTGAGG + Intronic
1007344914 6:41222341-41222363 GAAGCAGGAGGGAGACCTGGTGG + Intergenic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007652649 6:43432853-43432875 GAAGCTGGTGGGGACCATGTTGG + Exonic
1007785583 6:44277487-44277509 GAAGCAGGTGGGAGTAAGAGAGG + Exonic
1007899272 6:45394913-45394935 GAACCTAGTGGGACTCCTGGAGG + Intronic
1010422471 6:75690939-75690961 GAAGCTGATGGGGGGCAGGGGGG - Intronic
1010526624 6:76907606-76907628 GTAGCTTGTGGGAGTCAGGATGG + Intergenic
1011318959 6:86069146-86069168 GAAGTTTGTAGTAGTCATGGTGG + Intergenic
1011394201 6:86889265-86889287 GAAGCTGCTGGGAGTGAGGCTGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011549709 6:88519893-88519915 TGAGCTGGTGGGAGTGATGAGGG - Intergenic
1015210186 6:130687957-130687979 GAAGTTGGTTGGAGTTATGTTGG + Intergenic
1015661105 6:135574292-135574314 AAAGCTGGTGGGATGCATGATGG - Intergenic
1015837734 6:137439803-137439825 GAAGCTGCTGGAAGGCAAGGTGG - Intergenic
1016271366 6:142293950-142293972 GAAGAAGGAGGGAGTTATGGAGG - Intergenic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1018062052 6:160097755-160097777 GACAGTGGTGGGGGTCATGGGGG + Intronic
1019379998 7:716291-716313 GAAGCTGGTGGGAGGATTGTTGG - Intronic
1019631411 7:2051748-2051770 GCAGCTGGTGGGGGTGGTGGGGG - Intronic
1019666184 7:2253304-2253326 GAGGCTGTGGGGAGTCGTGGAGG - Exonic
1019777325 7:2919583-2919605 GAAGCTGGTGAAGGACATGGAGG - Exonic
1022523035 7:31020025-31020047 GAAGCTGGTGCTAGTCTTGGTGG + Intergenic
1023638430 7:42236522-42236544 GAAGGAGGCGGGAGGCATGGTGG - Intronic
1023874950 7:44281871-44281893 GAGGCAGGTGGGGGTCCTGGAGG - Intronic
1023956309 7:44889583-44889605 GCAGCTGGTGGCAGTGCTGGTGG + Intergenic
1023979747 7:45061862-45061884 GAGCCTGGTGGGGCTCATGGAGG + Intronic
1024162764 7:46695448-46695470 GAACCTGGTGGGGCTCCTGGAGG - Intronic
1024569745 7:50713801-50713823 GGAGATGGTGGAAGTGATGGTGG - Intronic
1025182801 7:56832169-56832191 GAAGCTGCTGGGAGGCAGGCAGG + Intergenic
1025923732 7:65939328-65939350 GAAACTGGTGGTGGTCGTGGAGG + Intronic
1026523632 7:71136446-71136468 CAAGCAGGTGGGATTTATGGAGG + Intronic
1027139667 7:75648246-75648268 GAAGCTGGTTGGAGTAGTTGGGG + Intronic
1027297683 7:76794723-76794745 GAAGCTGGTGGGTTTCATTTTGG - Intergenic
1027494255 7:78867733-78867755 GAAGGTGGTGATTGTCATGGTGG + Intronic
1028339730 7:89703830-89703852 GAAGGTGGTGGGGGTGATGGTGG + Intergenic
1029224389 7:99014427-99014449 GCAGCTGGTGGGTGTCCTGCTGG + Intergenic
1030061063 7:105621740-105621762 GGAGCTGCTGGGAGGCCTGGAGG - Intronic
1031097960 7:117443527-117443549 GAGGGTGGTGGTGGTCATGGTGG + Intergenic
1031997977 7:128245365-128245387 CAACCTGGTGGGAGTTATGAGGG - Intronic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032529391 7:132607847-132607869 GAGGATGATGGGAGTGATGGTGG - Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033259697 7:139831966-139831988 GAGGATGGAGGGAATCATGGTGG + Intronic
1033354186 7:140586154-140586176 GAAGCTGGTGGCAGCCATTGTGG + Intronic
1033443335 7:141399356-141399378 GAAGCTAGTGGGAAATATGGAGG + Intronic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1034402057 7:150868847-150868869 GAAGCTGGTGGGAAGCACAGGGG - Intergenic
1034950247 7:155291900-155291922 GAAGTAGGTGGGAGAGATGGGGG - Intergenic
1035035351 7:155891013-155891035 GGAGGTGGTAGGAGTGATGGAGG + Intergenic
1035035524 7:155891754-155891776 GAAGGTGGTGGAGGTGATGGAGG + Intergenic
1035039360 7:155916362-155916384 GATGGTGGTGGCAGCCATGGAGG - Intergenic
1035106915 7:156448907-156448929 GATGCTGATGGAAGTGATGGTGG + Intergenic
1035108802 7:156463504-156463526 GACGCTGGGGGGACGCATGGGGG + Intergenic
1035123093 7:156585345-156585367 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1040621375 8:49096331-49096353 GAAGCGGGAGGGAGGGATGGGGG - Intergenic
1040949821 8:52926115-52926137 GAACCTGGTGGGATTCCTGGTGG + Intergenic
1044818985 8:96143428-96143450 GAAGATGGTGGGCCTCAGGGAGG - Exonic
1045638842 8:104224061-104224083 TAAACTGGTGGGAGGCAAGGCGG + Intronic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1046889890 8:119411305-119411327 GAAGCTGGGGGAAGTCAGGAGGG - Intergenic
1047369985 8:124248074-124248096 GAAGCGGGGGGGAGGCATAGGGG + Intergenic
1048915094 8:139175166-139175188 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
1049301150 8:141871549-141871571 GAAGCAGGTGAGAGTGCTGGTGG + Intergenic
1049406802 8:142455236-142455258 GAGGCGAGTGGGAGTGATGGGGG - Intronic
1050286641 9:4109727-4109749 GAGGCTGGAGGAAGTCATGAAGG - Intronic
1050401964 9:5266010-5266032 GAAGCATGTGGGTGTCCTGGGGG + Intergenic
1050819482 9:9859547-9859569 GAAGGTGGGGGGAGTTATGTGGG - Intronic
1051472261 9:17457991-17458013 TCAGCTGGAGGGAGGCATGGGGG - Intronic
1051671047 9:19511024-19511046 TTAGCTGGGGGGAGTCATTGTGG + Exonic
1054860633 9:69949243-69949265 GAAGCAGGTGAGAGCCATGATGG + Intergenic
1055030245 9:71766924-71766946 GAAGCTGGGGGAAGTCATTTCGG + Intronic
1057518409 9:95740454-95740476 GAAGTTGGTGGGAGGCAAGGAGG + Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1058600606 9:106665872-106665894 GAAGCTGGTGAGAATCAGGGAGG - Intergenic
1059480873 9:114588362-114588384 GACGCTGGTAGTAGACATGGGGG - Intronic
1059489619 9:114656359-114656381 GAAGCTGGAGTGACTCTTGGTGG + Intergenic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060247628 9:121959461-121959483 GCTGCTGGTGCCAGTCATGGAGG - Intronic
1060329985 9:122659382-122659404 TAAGCAGGTGGAAGTGATGGGGG - Intergenic
1061248817 9:129414788-129414810 GGAGCCGGTGGGAGTCAGCGGGG + Intergenic
1061530451 9:131207904-131207926 GGAGCTGTTGGCAGTGATGGGGG + Intronic
1061777831 9:132977752-132977774 GATGCTGGGGGGAGTGAGGGCGG - Intronic
1061927446 9:133812867-133812889 GATCCTGGTGGGTGTCTTGGAGG - Intronic
1062648556 9:137563680-137563702 GAGGCTGGTGGGCTTAATGGTGG + Intronic
1185830682 X:3300025-3300047 GAAGCTAGTGAGATTCATGAAGG + Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1187551652 X:20312053-20312075 GAATGTGGTGGAAGTGATGGTGG + Intergenic
1190565895 X:51730084-51730106 GAACCTGGTGGGATTCCTAGTGG + Intergenic
1190958452 X:55220679-55220701 GAAGATGGTGCGAGTCCTGGGGG + Intronic
1191224308 X:58026079-58026101 GAAGCTGGTGGGGGCCACAGTGG + Intergenic
1191669433 X:63735392-63735414 CATGCATGTGGGAGTCATGGAGG - Intronic
1192215770 X:69157037-69157059 GAACCCAGTAGGAGTCATGGGGG - Intergenic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1200366234 X:155667603-155667625 GGAGATGGTGGTAGTGATGGTGG + Intronic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic