ID: 914523133

View in Genome Browser
Species Human (GRCh38)
Location 1:148436090-148436112
Sequence GAGGAAAACCATAATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914523133_914523140 20 Left 914523133 1:148436090-148436112 CCAACCCAATTATGGTTTTCCTC No data
Right 914523140 1:148436133-148436155 AGCCTTCTTGGTCTGGACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 168
914523133_914523138 8 Left 914523133 1:148436090-148436112 CCAACCCAATTATGGTTTTCCTC No data
Right 914523138 1:148436121-148436143 TTATACTGTGAAAGCCTTCTTGG 0: 1
1: 1
2: 4
3: 13
4: 148
914523133_914523139 13 Left 914523133 1:148436090-148436112 CCAACCCAATTATGGTTTTCCTC No data
Right 914523139 1:148436126-148436148 CTGTGAAAGCCTTCTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914523133 Original CRISPR GAGGAAAACCATAATTGGGT TGG (reversed) Intergenic
No off target data available for this crispr