ID: 914542156

View in Genome Browser
Species Human (GRCh38)
Location 1:148624811-148624833
Sequence TTCAAACATACGCATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914542151_914542156 -3 Left 914542151 1:148624791-148624813 CCACATTTCCATTGTTACTGTTC 0: 5
1: 0
2: 4
3: 22
4: 353
Right 914542156 1:148624811-148624833 TTCAAACATACGCATGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914542156 Original CRISPR TTCAAACATACGCATGGGGT TGG Intronic
No off target data available for this crispr