ID: 914552227

View in Genome Browser
Species Human (GRCh38)
Location 1:148725801-148725823
Sequence ATGTATTAGCTGACTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914552227_914552228 8 Left 914552227 1:148725801-148725823 CCTTATTTAGTCAGCTAATACAT No data
Right 914552228 1:148725832-148725854 CACTCTGATATTGTAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914552227 Original CRISPR ATGTATTAGCTGACTAAATA AGG (reversed) Intergenic
No off target data available for this crispr