ID: 914557011

View in Genome Browser
Species Human (GRCh38)
Location 1:148776192-148776214
Sequence GGCCATCAAAGTACTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914557009_914557011 -10 Left 914557009 1:148776179-148776201 CCATTTCTTTCATGGCCATCAAA No data
Right 914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914557011 Original CRISPR GGCCATCAAAGTACTGAGGT AGG Intergenic
No off target data available for this crispr