ID: 914557195

View in Genome Browser
Species Human (GRCh38)
Location 1:148777818-148777840
Sequence ACCAGTATGCTACTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914557186_914557195 11 Left 914557186 1:148777784-148777806 CCCCCTTATACATTCAGGCCTAG No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data
914557185_914557195 14 Left 914557185 1:148777781-148777803 CCTCCCCCTTATACATTCAGGCC No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data
914557191_914557195 8 Left 914557191 1:148777787-148777809 CCTTATACATTCAGGCCTAGGGA No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data
914557189_914557195 9 Left 914557189 1:148777786-148777808 CCCTTATACATTCAGGCCTAGGG No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data
914557187_914557195 10 Left 914557187 1:148777785-148777807 CCCCTTATACATTCAGGCCTAGG No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data
914557193_914557195 -7 Left 914557193 1:148777802-148777824 CCTAGGGATGGTAACAACCAGTA No data
Right 914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914557195 Original CRISPR ACCAGTATGCTACTGGTCAG AGG Intergenic
No off target data available for this crispr