ID: 914564578

View in Genome Browser
Species Human (GRCh38)
Location 1:148853496-148853518
Sequence AATTTATCCCAGCAAAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 4, 1: 0, 2: 0, 3: 25, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564578_914564583 20 Left 914564578 1:148853496-148853518 CCTTGCCTTTGCTGGGATAAATT 0: 4
1: 0
2: 0
3: 25
4: 221
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data
914564578_914564580 -6 Left 914564578 1:148853496-148853518 CCTTGCCTTTGCTGGGATAAATT 0: 4
1: 0
2: 0
3: 25
4: 221
Right 914564580 1:148853513-148853535 TAAATTTGTATACCCTTCAGAGG 0: 4
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564578 Original CRISPR AATTTATCCCAGCAAAGGCA AGG (reversed) Intronic
902666971 1:17946380-17946402 AATGTATTCCTGCAAGGGCAAGG - Intergenic
905496826 1:38396136-38396158 AAATTATCCAAGCAGAAGCATGG + Intergenic
905658548 1:39702149-39702171 GTTTTATCCCAGCAAGGGCAGGG + Intronic
907072646 1:51550838-51550860 AATTTATCCCAGGACACCCAAGG - Intergenic
907670060 1:56466509-56466531 AAATAACCCCAGCAAAGGTAGGG - Intergenic
907773812 1:57492882-57492904 AATTTCTCCAAGCAAAGTCAAGG - Intronic
910039172 1:82827249-82827271 TATTTACCACAGCAATGGCATGG + Intergenic
910735997 1:90458341-90458363 AATTGATCCCATTACAGGCAGGG + Intergenic
913037934 1:114991468-114991490 AATTTATCCCAGGAATGCCAGGG + Intronic
913582649 1:120242003-120242025 AATTTATCCCAGCAAAGGCAAGG - Intergenic
913625524 1:120656357-120656379 AATTTATCCCAGCAAAGGCAAGG + Intergenic
914564578 1:148853496-148853518 AATTTATCCCAGCAAAGGCAAGG - Intronic
914608248 1:149276746-149276768 AATTTATCCCAGCAAAGGCAAGG + Intergenic
915925833 1:160018856-160018878 AAGATAACCCAGGAAAGGCAAGG - Intergenic
916474038 1:165151319-165151341 AGTGTATCACAGCAGAGGCATGG + Intergenic
918040161 1:180909055-180909077 AATTTAACCCAGGAAAGACAGGG - Intergenic
918853968 1:189726956-189726978 TATTTACAACAGCAAAGGCATGG - Intergenic
919229878 1:194760707-194760729 TATTTATGACAGCAAAGACATGG + Intergenic
922797533 1:228348052-228348074 AATGTCTCCCAGGAAAGGAATGG + Intronic
923193551 1:231642753-231642775 AAATTATACCAGCAAGAGCAGGG - Intronic
924201266 1:241661695-241661717 AATTTACCCCAGCAAAGTAAAGG + Intronic
924831121 1:247596270-247596292 TATTTATACTAGCAAAGACATGG + Intergenic
1063520826 10:6739196-6739218 AACTTTTCCCAGCCAGGGCACGG - Intergenic
1064937928 10:20700139-20700161 AATTTATCCCTGTAGAAGCAAGG - Intergenic
1065147451 10:22783964-22783986 AATTTATCTCAGCAAAGTCTTGG + Intergenic
1065944219 10:30592459-30592481 AATTTTTTCCAGCAAAGAGAGGG - Intergenic
1066060658 10:31721004-31721026 GGTTTCTCCCAGCAAAGGCTGGG + Intergenic
1066701343 10:38132430-38132452 CATTTATCCCAGCAATGCAAGGG - Intergenic
1068080988 10:52316419-52316441 AATGTATCACACCAAAGGTAAGG + Exonic
1069879883 10:71585374-71585396 AATTGATCCCAGCACAAGGATGG + Intronic
1070359619 10:75674726-75674748 AATTAATAAAAGCAAAGGCAAGG - Intronic
1073861524 10:107748217-107748239 AAGTTATCCAAGCAAATGAAAGG + Intergenic
1074726258 10:116312889-116312911 TATTTTTCCTAGAAAAGGCATGG - Intergenic
1075647657 10:124107258-124107280 AAGTAATCCCAGGACAGGCAGGG - Intergenic
1078279384 11:9884769-9884791 AATTTAGCCCAGAAAACACATGG - Intronic
1079157462 11:17961438-17961460 AGTTTTTCCCAGCAGAGGAACGG - Intronic
1079311460 11:19370179-19370201 AATTGAGCTCAGCAAAGGAAAGG - Intronic
1081134573 11:39423572-39423594 AATTTAGCCTAGTACAGGCAAGG - Intergenic
1083151348 11:60793732-60793754 AATTTGTCCCATAGAAGGCAAGG + Intronic
1085251585 11:75147556-75147578 AAGTTGTGCCAACAAAGGCAGGG + Intronic
1087582543 11:100076683-100076705 AATTTATTCAAGTAAAAGCAAGG + Intronic
1088923915 11:114281518-114281540 AATTTAGACAAGCAAAGGGAGGG + Intronic
1089247672 11:117134172-117134194 AATTTATTCCAGTCCAGGCATGG - Intergenic
1089259093 11:117210693-117210715 AATTTATTCCAGGCCAGGCATGG + Intronic
1089910795 11:122098737-122098759 AATTTTTCACAACAAAGGAAAGG + Intergenic
1096365733 12:51026879-51026901 AAATTAGCCAAGCAAAGGCCGGG + Intronic
1097023451 12:56036575-56036597 AAATTATCCCAGCATGAGCACGG + Exonic
1098601861 12:72340964-72340986 ACTTTAACCCAGCTAAGCCATGG + Intronic
1100267126 12:92988180-92988202 AATTTGTCACAGCAAGGACAAGG + Intergenic
1103174542 12:118851193-118851215 AATTCATCACAGCAAAGCCCTGG + Intergenic
1104685243 12:130780625-130780647 AACCTATCCCAGCCAGGGCAGGG + Intergenic
1106299699 13:28452457-28452479 AATGAATCCCAGCAGAGGAAAGG + Intronic
1106389533 13:29321535-29321557 AAGTTTTGCCAGCAAAGGGAGGG + Intronic
1107437867 13:40396763-40396785 GATTTATCCCAGGAATGGAAGGG + Intergenic
1108878818 13:55083848-55083870 AATTTATCGCAGTAGAGGCAAGG - Intergenic
1110056012 13:70973107-70973129 AATTTAGCCCAGAAATGGTAAGG + Intergenic
1110200597 13:72845409-72845431 TATTTATAGTAGCAAAGGCATGG - Intronic
1110499742 13:76213325-76213347 AAATTGTCTCAGGAAAGGCAAGG - Intergenic
1111273986 13:85924175-85924197 AATTCAACCCAGCAATGGTAGGG + Intergenic
1111911783 13:94321338-94321360 AATTCATAATAGCAAAGGCATGG - Intronic
1112908591 13:104454524-104454546 CATTCATAACAGCAAAGGCATGG + Intergenic
1113016872 13:105837683-105837705 AATTTTCCCCAGCCAAGCCAGGG + Intergenic
1113600881 13:111567377-111567399 AATTTATCTAAGTAAAGCCAAGG - Intergenic
1114246931 14:20922950-20922972 AAATCATCCCAGCAAAGAGAAGG + Intergenic
1114654017 14:24305151-24305173 AATTTAAACCAGGAAAGGGATGG - Exonic
1114962634 14:27913287-27913309 TATTTATAACAGCAAAGACATGG + Intergenic
1115187077 14:30701103-30701125 AATTGCTACCAGCAAAGGAATGG - Intronic
1117022455 14:51585317-51585339 AATTTGTCCCAGCGGAGGGAGGG + Intronic
1118049672 14:62013346-62013368 AATTTCTTGTAGCAAAGGCATGG - Intronic
1118627262 14:67671065-67671087 AATTTATCTAAGCAAACACATGG - Intronic
1119796815 14:77405907-77405929 AATTTGTCTCAGGAAAGGTAAGG - Exonic
1126067069 15:44834127-44834149 AAATTATACCAGCAAAGTGATGG - Intergenic
1126092761 15:45066451-45066473 AAATTATACCAGCAAAGTGATGG + Intronic
1126709018 15:51436468-51436490 GATTTATCCCAGAAGATGCAAGG - Intergenic
1126826549 15:52556350-52556372 AATTTTTTACAGCAAAGGAAGGG + Intronic
1127361364 15:58247529-58247551 AAGATAGCCCAGCAGAGGCAGGG + Intronic
1128006008 15:64242201-64242223 AACTTATTCCATCAAAGGAAAGG + Intronic
1131002745 15:88951615-88951637 AGTTTCTCCCAGCAGAGGCTGGG + Intergenic
1131468823 15:92677653-92677675 AAATTATCCCATCAAAAGCATGG + Intronic
1132107074 15:99070862-99070884 AATTTATACCAGCCAGGGTAGGG - Intergenic
1132238277 15:100238099-100238121 AATTTCTGTGAGCAAAGGCAGGG - Intronic
1133641343 16:7720211-7720233 AATCTATACCAGAGAAGGCAAGG - Intergenic
1134251752 16:12578934-12578956 AATTTATAACAGCAAAGACAAGG + Intergenic
1134314921 16:13109820-13109842 AATTTATACCTGCTAAGACAGGG - Intronic
1135084194 16:19461940-19461962 ATTTTTCCCCAGCAAAGTCAGGG - Intronic
1136062866 16:27738645-27738667 AATTTATCCCATCATCGGCATGG + Intronic
1138445487 16:57060754-57060776 ATTTTATCTCAGAAAAGGCAAGG - Intronic
1138908695 16:61369593-61369615 AATTGATCTCAGCAGAGGAAAGG - Intergenic
1139693812 16:68658314-68658336 TATATATCCCAGCACAGGCAAGG + Intronic
1140558912 16:75954534-75954556 CTCTTCTCCCAGCAAAGGCAAGG - Intergenic
1140576941 16:76181805-76181827 ATTTTACAGCAGCAAAGGCAAGG + Intergenic
1141813584 16:86393487-86393509 AATGTAACCCCGCAAGGGCAGGG - Intergenic
1142757438 17:2024530-2024552 ACTTTATCCCAGCAAAGCAAAGG + Intronic
1150450502 17:65263093-65263115 TATTCATCACAGCAAAGACATGG + Intergenic
1153646048 18:7197020-7197042 CATTTATCCTAGGAAAGGAAAGG - Intergenic
1153710740 18:7796457-7796479 AATTGGCTCCAGCAAAGGCAGGG - Intronic
1155522505 18:26683243-26683265 AATTCATGCCAGCAAGGGTATGG + Intergenic
1157322099 18:46642465-46642487 AACTTTTCCCAGCAAAAGCAAGG - Intronic
1157638661 18:49188897-49188919 TATTTATAATAGCAAAGGCATGG + Intronic
1164624399 19:29716555-29716577 GTTTTATCCCAGCCAAGGCCTGG - Intergenic
1164694475 19:30233138-30233160 ATTGTATCTGAGCAAAGGCATGG + Intronic
1164949551 19:32325581-32325603 AATTTATCACAGCAAAAGACTGG + Intergenic
1165239536 19:34454432-34454454 TTTTTTTCCCAGCAATGGCAGGG + Exonic
1166668317 19:44694903-44694925 GATTTAGCCCAACAAAGGAAAGG + Intergenic
1168093547 19:54101442-54101464 AATTAATCACAGCAAGGGCCTGG - Intronic
928863663 2:35891816-35891838 AAGTTCTCCCAGCAAAGACCAGG - Intergenic
929639427 2:43562071-43562093 AATTTATCCCAGGAATGTAAGGG - Intronic
932527468 2:72486583-72486605 CAGTTTTCCCAGCAAATGCAGGG - Intronic
933228516 2:79779028-79779050 TATTTATTCCAGCCAAGGGAAGG + Intronic
933421752 2:82056256-82056278 TATTTATACTAGCAAAGACATGG + Intergenic
934078648 2:88449480-88449502 AATTTATGCCATCCAATGCATGG - Intronic
937371458 2:121300496-121300518 AATTTACTTCAGAAAAGGCAAGG - Intergenic
939091394 2:137783685-137783707 GACTTTTCCCAGCATAGGCAGGG - Intergenic
939155504 2:138520473-138520495 AATTTTTACCAAAAAAGGCATGG + Intronic
939658190 2:144853435-144853457 AATTAATCACAGAAAATGCAGGG + Intergenic
939715483 2:145578762-145578784 AGTTAATCCCAGCAAAAGCAGGG + Intergenic
940604142 2:155898626-155898648 TATTTATTCTACCAAAGGCAAGG - Intergenic
941370959 2:164663518-164663540 AATTCACCACAGCAAAGACATGG + Intronic
943996502 2:194772981-194773003 AATTTAACCAAGTAAATGCAGGG - Intergenic
944616751 2:201468194-201468216 AGTTTAACAGAGCAAAGGCAAGG + Intronic
944629614 2:201610786-201610808 GATTTATCCCAGTGAATGCAAGG + Intronic
946838491 2:223796490-223796512 AGTTTATCCCAGAAACAGCAGGG + Intronic
946973931 2:225126734-225126756 TATTTATAACAGCAAAGTCATGG - Intergenic
947694699 2:232175340-232175362 AATTTATCCCAGGAATGTGATGG - Intronic
1168956980 20:1841253-1841275 AACTGATCCCAGGAGAGGCAGGG + Intergenic
1169008230 20:2227320-2227342 AATTTATAGCAGCCTAGGCAAGG + Intergenic
1171040261 20:21756315-21756337 CATTTCTCCCTGCAAAGTCATGG + Intergenic
1172163068 20:32881915-32881937 AAATTATCCCTGCCCAGGCATGG + Intronic
1173061103 20:39661958-39661980 TATTTGTCCCAGCAAATGCTGGG - Intergenic
1174907459 20:54566415-54566437 AATTTATCCCAGAAATGGAGAGG - Intronic
1174996977 20:55581013-55581035 AATTTAGTCCATCCAAGGCAGGG - Intergenic
1175150600 20:56931005-56931027 GAGTTTTCCCAGGAAAGGCATGG + Intergenic
1182317873 22:29459894-29459916 AAACAAGCCCAGCAAAGGCAGGG - Intergenic
1182698170 22:32210123-32210145 GATGTAGCCCAGCAAGGGCAGGG + Intergenic
1182713455 22:32336764-32336786 GATTTTTCCAAGCAAAGCCAGGG + Intergenic
1184400709 22:44272333-44272355 GATTTTTCCAAGCAAAGCCAGGG + Intronic
949788780 3:7770331-7770353 AAAATATCCCACCAGAGGCAAGG + Intergenic
950665632 3:14493283-14493305 ACTTCCTCCCAGCAAAGCCATGG - Exonic
952158032 3:30664993-30665015 AATTTATCCGAGCAATAGAAAGG + Intronic
952931397 3:38363842-38363864 AAGTGATCCCAGCACAGCCAAGG - Intronic
953488978 3:43331485-43331507 AAAGTATTCCAGCAAAGGCAGGG - Intronic
955056896 3:55462865-55462887 AATTTATGGCTGCAAAGGTAGGG - Intergenic
955158522 3:56441840-56441862 AATTTATCCCAGGGAAGGCTGGG - Intronic
955205595 3:56893154-56893176 AAAAAATCCCAGCAAAGGGAAGG - Intronic
957185101 3:76931069-76931091 AATGAATCAGAGCAAAGGCAAGG + Intronic
957668540 3:83269180-83269202 TATTCATGACAGCAAAGGCATGG - Intergenic
957894830 3:86408502-86408524 CATTTTTCCCACCAAAAGCATGG - Intergenic
958521931 3:95201716-95201738 AATTTACAATAGCAAAGGCATGG - Intergenic
959016079 3:101135511-101135533 TATTTATAACAGCAAAGACAAGG + Intergenic
960070207 3:113421555-113421577 TATTTATAACAGCAAAGACATGG + Intronic
961978565 3:131052920-131052942 AATTTACCCCAGCAAATTTAAGG - Intronic
963089384 3:141468101-141468123 TATTTATCATAGCAAAGTCAAGG - Intergenic
963513709 3:146281036-146281058 AATTGCTCCCAGCAATGGAATGG - Intergenic
965439615 3:168697208-168697230 CATTTATCCCACCAAATGCCTGG - Intergenic
965853067 3:173054353-173054375 AATTTACAACAGCAAAGACATGG + Intronic
966014285 3:175122157-175122179 AGTTTATATCAGCATAGGCAGGG - Intronic
966318448 3:178674841-178674863 AGTTTGTTCCAGCAATGGCAAGG - Intronic
966846376 3:184134054-184134076 GATTTATCCTAGAAAAGGAAAGG - Intergenic
968362633 3:198158089-198158111 AGTTTATTTCAGCAAAGGAATGG + Intergenic
968546326 4:1200786-1200808 ACTTGCTCACAGCAAAGGCAGGG - Intronic
969125870 4:4947473-4947495 AAGTTACAACAGCAAAGGCAGGG - Intergenic
969836068 4:9842883-9842905 AGTTGATCCCAGGAAATGCAGGG + Intronic
970603471 4:17658597-17658619 AAAACATCCCAGGAAAGGCAAGG - Intronic
970680560 4:18502607-18502629 AAGTGCTCTCAGCAAAGGCAGGG + Intergenic
972100554 4:35409250-35409272 AATTTAACCCAGTTAAGGAAAGG - Intergenic
972153805 4:36130559-36130581 AATTTTACCCAGAGAAGGCATGG - Intronic
980177312 4:129362735-129362757 TCTTTGTCCTAGCAAAGGCATGG - Intergenic
980487349 4:133475865-133475887 AACTTAGCCCTGCAAAGGCCTGG + Intergenic
980504764 4:133703106-133703128 AATTTATGCCAAAAAAGGAAGGG + Intergenic
981402739 4:144333327-144333349 AATTTATCCCTACAAAAGCAGGG + Intergenic
982763518 4:159316739-159316761 AATTCATAACAGCAAAGACATGG - Intronic
983962504 4:173771726-173771748 CACTTATCCCAGGAAAGGAAGGG - Intergenic
986635965 5:9822837-9822859 AATTTTTACCAGCAAAAGAATGG - Intergenic
988297235 5:29381066-29381088 AATTTATACGACAAAAGGCAGGG - Intergenic
989436839 5:41423809-41423831 AATATATCTCAACAAAGGTAGGG - Intronic
990033968 5:51297094-51297116 AATTGTTCCCACCTAAGGCAAGG - Intergenic
990142963 5:52726677-52726699 AATTCATACCAGAAAAGTCATGG - Intergenic
993040488 5:82809195-82809217 ATTTTATCACAGCAACAGCATGG + Intergenic
993117149 5:83733006-83733028 TATTTATTGCAGCAAAGACATGG - Intergenic
993491095 5:88550757-88550779 TATGTATTCCAGCATAGGCAAGG + Intergenic
995713031 5:115053846-115053868 AATTTATCCTAGGAGAGGAAGGG - Intergenic
997043431 5:130284985-130285007 AATTTATATCTGCAAAAGCAGGG + Intergenic
998254128 5:140571863-140571885 AATTAATCACACCAAAGGCAGGG + Intronic
999329819 5:150665335-150665357 AATTCATCCCACCTGAGGCAAGG + Intronic
1000257870 5:159558084-159558106 AATTAATCCTGGCAAAGGCTGGG + Intergenic
1000314813 5:160079697-160079719 AATCTATGGCAGGAAAGGCAAGG + Intronic
1000965358 5:167649269-167649291 AACTTGCACCAGCAAAGGCAAGG - Intronic
1002558982 5:180067791-180067813 AATTCATAACAGCAAAGGCAGGG - Intronic
1003991398 6:11490191-11490213 AAGTTATCCCAGCCAAGGTCAGG + Intergenic
1004838572 6:19556791-19556813 CATTTATCCCAACACCGGCAAGG + Intergenic
1010002255 6:70958879-70958901 ATTTTATTCCAGCAAACACAAGG - Intergenic
1011215705 6:85003566-85003588 AAATTATCCAAGAGAAGGCAAGG - Intergenic
1011289127 6:85757817-85757839 AATTCATCCCAGTAATGGGATGG + Intergenic
1011520819 6:88203632-88203654 AATTTATCCCAGGAATGCAAGGG + Intergenic
1012187917 6:96244351-96244373 AATTTATGCCAACAAACGAAGGG + Intergenic
1014484223 6:121979345-121979367 TATTTATAAGAGCAAAGGCATGG - Intergenic
1014912367 6:127110417-127110439 AATTTGTCCCACCAATGGCCTGG + Intergenic
1015583419 6:134751079-134751101 AATTTATGCCTGAAAATGCAGGG - Intergenic
1020562679 7:9749934-9749956 AAATTATCCCGCAAAAGGCAAGG - Intergenic
1021495020 7:21264914-21264936 AATTTATATTAGAAAAGGCAGGG + Intergenic
1022198113 7:28089226-28089248 TATTAATCCCATCATAGGCAAGG - Intronic
1023382295 7:39621837-39621859 AATTTTCCCAAGTAAAGGCAGGG + Intergenic
1023696832 7:42856596-42856618 AATTTATGCTAGAAAAGGCTTGG + Intergenic
1027429050 7:78090838-78090860 CAGTTATGCCAACAAAGGCATGG - Intronic
1029225574 7:99025581-99025603 AATTTATCCCAGGAAGGGAAAGG + Intergenic
1030735604 7:113044216-113044238 AATTTCTCCCTGCAACGGAAAGG + Intergenic
1031345929 7:120666673-120666695 AATTTAGCCCAGCAAACTTAGGG - Intronic
1032841727 7:135719462-135719484 AATTAAAACCAGCAAGGGCAGGG - Intronic
1033450813 7:141461047-141461069 ATTTAATCTAAGCAAAGGCAGGG + Intronic
1035688583 8:1544646-1544668 AATTTATCCTAGCAATGCAAGGG - Intronic
1037187894 8:16086804-16086826 AAGTTATCCCAGCAAGAGCAAGG + Intergenic
1039202942 8:35116863-35116885 TATTTATCTCAGCAAAAACACGG - Intergenic
1039363685 8:36907722-36907744 CATTTAACCCAGCAAAGGACTGG + Intronic
1041361458 8:57058975-57058997 AATAAACCCCATCAAAGGCAAGG + Intergenic
1041563901 8:59253206-59253228 AATTAATCCCACCAAAGTAAGGG - Intergenic
1041779758 8:61564656-61564678 AATTCAGCACAGAAAAGGCAGGG - Intronic
1044023659 8:87139727-87139749 AATTGATGCCAGCAAAGACTAGG + Intronic
1044459934 8:92432172-92432194 AATTTCTTGCAGCAAAGGCAAGG + Intergenic
1046165610 8:110430649-110430671 TATTTATACAAGCAAAGACATGG - Intergenic
1047439747 8:124867058-124867080 AAATTATGCCAGAAAAAGCAGGG - Intergenic
1048314514 8:133352257-133352279 AGTTTATCCCATAACAGGCAGGG + Intergenic
1050381792 9:5038819-5038841 GATTTATCCCAGGAAATACAAGG + Intronic
1051078393 9:13267642-13267664 AATTTATCTGAGAAAAGACATGG + Intronic
1054140533 9:61525348-61525370 AATTTCACCCAGAAAATGCAAGG - Intergenic
1056187039 9:84145452-84145474 AATTTATGGCAGGAAAGGCTGGG + Intergenic
1058261105 9:102833204-102833226 ATTTGATTCCAGCAATGGCAGGG - Intergenic
1058289662 9:103223486-103223508 AATTTATAATAGCAAAGACATGG + Intergenic
1058671161 9:107361659-107361681 AAATTATCCCAGCAGTGGGAAGG + Intergenic
1059632627 9:116141019-116141041 ATTTTGTCCCAGCAAAGCCCAGG + Intergenic
1059949728 9:119449767-119449789 GATTGATCCCAGCAAAGACTGGG + Intergenic
1060751937 9:126175751-126175773 AATTTATCCCAATAATGGGAGGG + Intergenic
1062372658 9:136248016-136248038 AGTTTCTCCCATCTAAGGCAGGG + Intergenic
1062747321 9:138221752-138221774 AGTTTATTTCAGCAAAGGAATGG + Intergenic
1186225857 X:7398270-7398292 AATTTCTCCCAGCAACTGCAGGG + Intergenic
1188453167 X:30330850-30330872 AATTTATCCCAGGAATGCAAAGG - Intergenic
1189941226 X:46123731-46123753 AATTTATCCCAGGAATGCAAGGG - Intergenic
1190896676 X:54625494-54625516 AATTTATCCCAGGAATGCAAGGG - Intergenic
1191777548 X:64832686-64832708 TATTCATGACAGCAAAGGCATGG - Intergenic
1192540174 X:71962144-71962166 GATTTATCCCAGGAAAGTAAGGG - Intergenic
1192778189 X:74266691-74266713 ACTTAAGCCCACCAAAGGCAAGG + Intergenic
1193265024 X:79457644-79457666 AATTTATCCCAGCTAAAATATGG + Intergenic
1193460894 X:81790084-81790106 AGTTTCTTCCAGCAGAGGCACGG - Intergenic
1193587966 X:83350584-83350606 GATTTACCACGGCAAAGGCAAGG - Intergenic
1195579421 X:106484431-106484453 AATTGAAACCAGCAAAGCCATGG + Intergenic
1196894957 X:120326302-120326324 AATTTATTACAGGAAATGCAAGG - Intergenic
1196967550 X:121074850-121074872 AATTTATCCCAGGTACGGAAGGG - Intergenic
1197258564 X:124291362-124291384 ACTTTATTCCAGCAATGGGATGG + Intronic
1198707513 X:139464536-139464558 CATTTATTCCTGCAGAGGCAAGG + Intergenic
1199900322 X:152166462-152166484 GCATTATCCCAGCAATGGCAAGG + Exonic
1201595853 Y:15668060-15668082 AATTTCTCCCAGCAACTGCAGGG + Intergenic