ID: 914564579

View in Genome Browser
Species Human (GRCh38)
Location 1:148853501-148853523
Sequence ATACAAATTTATCCCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564579_914564583 15 Left 914564579 1:148853501-148853523 CCTTTGCTGGGATAAATTTGTAT No data
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564579 Original CRISPR ATACAAATTTATCCCAGCAA AGG (reversed) Intronic
No off target data available for this crispr