ID: 914564581

View in Genome Browser
Species Human (GRCh38)
Location 1:148853525-148853547
Sequence TTCTGAATCTAACCTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 4, 1: 0, 2: 2, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564581_914564586 16 Left 914564581 1:148853525-148853547 CCCTTCAGAGGTTAGATTCAGAA 0: 4
1: 0
2: 2
3: 18
4: 172
Right 914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG 0: 4
1: 0
2: 0
3: 18
4: 288
914564581_914564583 -9 Left 914564581 1:148853525-148853547 CCCTTCAGAGGTTAGATTCAGAA 0: 4
1: 0
2: 2
3: 18
4: 172
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data
914564581_914564587 17 Left 914564581 1:148853525-148853547 CCCTTCAGAGGTTAGATTCAGAA 0: 4
1: 0
2: 2
3: 18
4: 172
Right 914564587 1:148853565-148853587 TATTTTTAGAACCTAGATCTGGG 0: 4
1: 0
2: 2
3: 24
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564581 Original CRISPR TTCTGAATCTAACCTCTGAA GGG (reversed) Intronic
912265655 1:108154638-108154660 GTCACAATCTAACCTCTGGAAGG - Intronic
913582652 1:120242032-120242054 TTCTGAATCTAACCTCTGAAGGG - Intergenic
913608968 1:120492400-120492422 CTCTCAATCTTACCTGTGAAGGG - Intergenic
913625521 1:120656328-120656350 TTCTGAATCTAACCTCTGAAGGG + Intergenic
913986471 1:143570267-143570289 CTCTCAATCTTACCTGTGAAGGG + Intergenic
914204859 1:145518051-145518073 CTCTCAATCTTACCTGTGAAGGG + Intergenic
914370708 1:147022176-147022198 CTCTCAATCTTACCTGTGAAGGG - Intergenic
914483982 1:148091237-148091259 CTCTCAATCTTACCTGTGAAGGG + Intergenic
914564581 1:148853525-148853547 TTCTGAATCTAACCTCTGAAGGG - Intronic
914582223 1:149029438-149029460 CTCTCAATCTTACCTGTGAAGGG + Intronic
914608245 1:149276717-149276739 TTCTGAATCTAACCTCTGAAGGG + Intergenic
916679481 1:167090840-167090862 GTCAGAATATAAACTCTGAAGGG - Intergenic
916842923 1:168618324-168618346 TTCTGCATCTAAAGACTGAATGG + Intergenic
916967954 1:169972676-169972698 TTCTAAATCTAAATTCTAAATGG + Intronic
920944347 1:210514616-210514638 TTCTGAATCTAATCATTGATAGG - Intronic
922370315 1:224904024-224904046 GTCTGAGTCTAAACTCTGCAAGG - Intronic
922781838 1:228258807-228258829 TTCTCATTCTATTCTCTGAAAGG - Intronic
923981052 1:239324434-239324456 TTCTGAACCTAAGGACTGAAAGG + Intergenic
1064894951 10:20224929-20224951 TTATGAACCTGAACTCTGAAAGG + Intronic
1066288822 10:33995221-33995243 TTCTGATCCTAACTACTGAATGG - Intergenic
1066381788 10:34907951-34907973 TTCCAAATCTGTCCTCTGAATGG + Intergenic
1067191193 10:44069524-44069546 CTCAGGATCTAACCTCTGAAAGG - Intergenic
1068265519 10:54643321-54643343 TTCTAAACCTCAACTCTGAAAGG + Intronic
1068822933 10:61398965-61398987 TTGTAAAGGTAACCTCTGAAAGG + Intergenic
1069722303 10:70557564-70557586 TTCTGTACCTAACCCCTGGAAGG - Intronic
1071088319 10:81890172-81890194 TTCTGCATCTGAACTCTGCAGGG + Intronic
1071108657 10:82128491-82128513 ATCATAATCTAACCTCTAAATGG - Intronic
1071263568 10:83943356-83943378 TGATGAATCTAACATCCGAATGG + Intergenic
1071681300 10:87708166-87708188 TCCTGATTCTAAACTCTGACTGG - Intronic
1072753895 10:98004252-98004274 TTCTGATTCAAACTGCTGAAAGG - Intronic
1075586373 10:123661226-123661248 TCCTGAAGTTAACATCTGAATGG + Intergenic
1077903005 11:6505141-6505163 TTCTGAGTCTCAACTCTGCAAGG + Intronic
1078105553 11:8356119-8356141 ATCTGAATCTGTGCTCTGAAAGG - Intergenic
1078374201 11:10779509-10779531 TTCTCAATCTAAACTCAAAATGG - Exonic
1079358390 11:19749476-19749498 GACTGAATCTAAACTCTGACAGG - Intronic
1081077935 11:38698522-38698544 TTCTTCATCTCACCACTGAAAGG + Intergenic
1081873744 11:46395131-46395153 GTCTAAATCCCACCTCTGAAAGG + Intergenic
1086486632 11:87310382-87310404 ATCTGAATATAATCTCTAAATGG + Intronic
1087261703 11:96019366-96019388 TTTTGAATATAATCTCTGTAGGG + Intronic
1089914372 11:122138443-122138465 TTCTGAATATAATCTCAGTAGGG - Intergenic
1090744738 11:129696670-129696692 TGCTGAAACTTCCCTCTGAAAGG + Intergenic
1093014425 12:14142288-14142310 TCCTGAATCTAAAATATGAATGG - Intergenic
1093362224 12:18243973-18243995 TACTGAATATAAGCTCTGGAAGG - Intronic
1096230686 12:49895285-49895307 GTGAGAATCTGACCTCTGAATGG - Intronic
1097432087 12:59522562-59522584 TTCTAAATCTTACTTCTGATTGG + Intergenic
1100918622 12:99456145-99456167 TTCTGAATCTAGCCTCCCAGTGG - Intronic
1101404966 12:104420400-104420422 TTCTGGATCTTTCCTCAGAAAGG + Intergenic
1102196932 12:111033095-111033117 TTCTGAACCAAACCTCTGGAGGG - Intergenic
1103042471 12:117707154-117707176 TTCTGAATATTACATATGAATGG - Intronic
1106411908 13:29516467-29516489 ATTTGATTCTAAGCTCTGAATGG + Intronic
1107153438 13:37139254-37139276 TGCGGCATCTGACCTCTGAATGG + Intergenic
1107910751 13:45103667-45103689 TTGAAAATCTAACCTCTGAAGGG + Intergenic
1109068076 13:57726143-57726165 CTCTGAATCTTACCACTCAATGG - Exonic
1112429049 13:99333581-99333603 ATCTAAATGTAAACTCTGAATGG - Intronic
1112765769 13:102741324-102741346 TTCTGAATCTTTCCTCAGTAAGG - Exonic
1113070550 13:106416672-106416694 TTCTGAGAATAACCACTGAAAGG + Intergenic
1113315114 13:109171190-109171212 TTCTGACTCTGCCCTCTGTATGG - Intronic
1117099616 14:52333226-52333248 TTTTTAAACTAACCACTGAAAGG + Intergenic
1118086036 14:62418549-62418571 TCATGACTCTAACCTCTCAATGG - Intergenic
1121953523 14:98193495-98193517 TGCTGAATTGAACCTCAGAATGG - Intergenic
1122134441 14:99624779-99624801 TTCTGAATTTGGCCTCTGTATGG - Intergenic
1129286686 15:74531179-74531201 TTCTGTCTCTCACCTGTGAATGG - Intergenic
1129378474 15:75150478-75150500 TTCTCATTGTAACCTCTCAATGG - Intergenic
1129781081 15:78271679-78271701 TTCTGCATCTCACCTCTGCCAGG + Intronic
1130287370 15:82567181-82567203 TTCTGAATGTCGCCTCAGAATGG + Intronic
1130387285 15:83422823-83422845 GTCTGAATCTCAGCTCTGGAGGG + Intergenic
1133240987 16:4414374-4414396 TTCTGAAACTAAGATCTGCAAGG + Intronic
1134412330 16:14013335-14013357 TTTAGAATCTAACTTCTTAAGGG + Intergenic
1135390816 16:22091961-22091983 TTCTGAATCAATCTCCTGAATGG + Intergenic
1137023131 16:35450053-35450075 TTCTGAATCTCACATCTGAAGGG - Intergenic
1137380779 16:47997521-47997543 TTCTGGATCTCACGTCTTAATGG + Intergenic
1140961136 16:79914265-79914287 TTCTGAATCTAAAAAATGAAGGG + Intergenic
1145875746 17:28317480-28317502 TTCTGAACCCAAACTCTGTAGGG + Intergenic
1146503240 17:33382238-33382260 TTTTGAATCTGAGCTCTGCATGG - Intronic
1150016342 17:61561145-61561167 GTCTAAATTTAAGCTCTGAAAGG - Intergenic
1150242529 17:63646624-63646646 TTCTGAATCTTACCTCATTAGGG + Intronic
1151779030 17:76230044-76230066 TTCTGAATATATCATGTGAATGG + Intronic
1155669507 18:28351650-28351672 TTCTTTATCTAACCTCAGGATGG + Intergenic
1156356593 18:36347346-36347368 CTCTAAATTTAAGCTCTGAATGG + Intronic
1156828547 18:41463328-41463350 TTCTGCAACTCAACTCTGAATGG - Intergenic
1158115042 18:53985887-53985909 TTCTAAAAATAACCTCTAAAAGG - Intergenic
1158224187 18:55183401-55183423 TTCTGAGTCTAACCTTCAAAAGG + Intergenic
1159868373 18:73732291-73732313 TTCTTATTCTAACGCCTGAATGG - Intergenic
1162232671 19:9280771-9280793 TTCTGAATCCATCTTCTGGAAGG - Intergenic
1164255579 19:23525295-23525317 TTCTGAATCTCAACCCTGGAGGG - Intergenic
1166328318 19:42064841-42064863 GTCTGAAACTGAGCTCTGAAAGG - Intronic
1167788664 19:51657003-51657025 CCCTGAATCAAACCTCTGCATGG - Intergenic
1168031422 19:53682963-53682985 ATGTGAATCTTACCACTGAAGGG + Intergenic
1168038277 19:53737868-53737890 GTGTGAATCTTACCACTGAAGGG + Intergenic
926432508 2:12802775-12802797 TTCCTATTCTAAGCTCTGAAGGG + Intergenic
928046738 2:27941685-27941707 TTCTGACTTTTTCCTCTGAAAGG - Intronic
928253709 2:29703930-29703952 TTCTGAATGTCACCTCTTCAGGG + Intronic
928932508 2:36638347-36638369 TGCTGAATGTAATGTCTGAAAGG - Intronic
930647150 2:53922823-53922845 TTTTGAAGGTAACCTCTGAATGG + Intronic
931093355 2:58911608-58911630 TTTTGAATCTATTTTCTGAAAGG + Intergenic
931306340 2:61032808-61032830 TTCTTTATCTAACTTTTGAAAGG - Intronic
931591661 2:63890409-63890431 TACTGAATATAACCTATTAAAGG + Intronic
932046610 2:68356651-68356673 GTCGGAATCAAACCACTGAAAGG + Intergenic
936901193 2:117483874-117483896 TTCTGAATCTTCTGTCTGAAAGG + Intergenic
938451026 2:131420448-131420470 TTCTGAATTTAAGCTCTGTAAGG + Intergenic
939032851 2:137097051-137097073 TTCTGAAGTAAGCCTCTGAAGGG - Intronic
939978688 2:148752177-148752199 AGCTTAATCTAACCTCCGAATGG - Intronic
942193443 2:173493853-173493875 TTCTGCACCCAACCTCTGAGTGG - Intergenic
943358547 2:186890429-186890451 TTCTGAATCATACCTCTGTATGG - Intergenic
945770909 2:214040857-214040879 TCCTGAATCTAAATGCTGAAAGG - Intronic
1169655351 20:7916753-7916775 TTCTGTAGCTAACCACTGACCGG - Intronic
1176364108 21:6022284-6022306 TGCTGATTCTTGCCTCTGAATGG - Intergenic
1176944795 21:14966392-14966414 TACTGCATCTAACCACTCAATGG - Exonic
1178199751 21:30390420-30390442 TTCTTCATCTAACCTCTGGAAGG - Intronic
1179202097 21:39234309-39234331 TTGGGAAGCTAACCTCTTAATGG + Intronic
1179759410 21:43516261-43516283 TGCTGATTCTTGCCTCTGAATGG + Intergenic
1181777017 22:25166990-25167012 CTCTGAATCTGACCTCTGAAGGG + Intronic
1183757792 22:39786075-39786097 TTCTGAACCTCAGGTCTGAAGGG - Intronic
1183789192 22:40051247-40051269 TTCTGAATTGTACCTCTGCATGG + Intronic
952036515 3:29208804-29208826 TTCTGAATTTAAATTCTGCAGGG - Intergenic
953529749 3:43729714-43729736 TTCTGAATATAACTTCTGCCTGG - Intronic
954482046 3:50808699-50808721 TTCTGGATCTTACCCTTGAAGGG + Intronic
957017021 3:75078290-75078312 CTCTCAAGCTAACCTCTGATTGG + Intergenic
958126752 3:89366104-89366126 TTCTGGTTTTAATCTCTGAAAGG - Intronic
960310783 3:116113958-116113980 TACTGAATTTAACTTCTAAATGG + Intronic
960795185 3:121478174-121478196 TTCTGAAACAAAACTCTCAAAGG + Intronic
961528297 3:127523074-127523096 TTCTGAATCTGACCACTCTAAGG - Intergenic
961992307 3:131205091-131205113 TTAGGAAACTAACCTCTGTATGG + Intronic
965525685 3:169715575-169715597 TTCAGAGACTAACCTCTGAGAGG - Intergenic
968929289 4:3570046-3570068 TTCTGTCTCTAACCACTGAAAGG + Intergenic
971132234 4:23825154-23825176 TTCTGAATCTTACCTCCTACAGG + Intronic
973027121 4:45286205-45286227 TTCTGATACTAATCTCTAAAAGG + Intergenic
974159675 4:58121886-58121908 TTCTAAATCTTACATCTGCAGGG + Intergenic
980164367 4:129207521-129207543 TTCTGAATTATACCTCAGAATGG - Intergenic
980199844 4:129641913-129641935 TGGTGAATCTAAGCTCTGACAGG - Intergenic
983997511 4:174203550-174203572 TTTTGAATGTAACTGCTGAAAGG - Intergenic
990081677 5:51923793-51923815 TTGTGAAACTAAGCTCTGAAAGG + Intergenic
990469940 5:56106036-56106058 TGCTGCATCCAACCTCTGACAGG + Intronic
990710183 5:58572068-58572090 TTCTGAATCTAGGCTCTAAGAGG + Intergenic
992126516 5:73647885-73647907 GTCTGGATCAAACATCTGAAAGG + Intronic
992584480 5:78221807-78221829 TTCTGAATCTACATTTTGAAAGG + Intronic
992733273 5:79693281-79693303 TTCTGAATCTAAAATCAGATCGG - Intronic
993132875 5:83921447-83921469 TTCTAAATCTAACCTAGGATGGG - Intergenic
993166773 5:84365949-84365971 TTATGTATATAACCTCTAAAAGG + Intronic
993828096 5:92718716-92718738 TTTTGTATCTATTCTCTGAATGG - Intergenic
993843766 5:92913993-92914015 TTCTGTATCTCACCTCACAATGG + Intergenic
994974270 5:106781157-106781179 TTTTGAATTTACTCTCTGAAAGG - Intergenic
998399367 5:141840430-141840452 TTCTGACGCTATCCTCTAAATGG + Intergenic
1000305973 5:159995033-159995055 TTCTAAATCTAAGATCTAAAGGG + Intergenic
1001727517 5:173918586-173918608 TTCTCCCTCTAGCCTCTGAATGG + Intronic
1003050738 6:2778783-2778805 ATCTGAATATTAGCTCTGAAGGG - Intronic
1004868661 6:19880213-19880235 TTCTGAATCAAGCCTCTCATGGG - Intergenic
1006000322 6:30959592-30959614 GTCCCAATCTCACCTCTGAAAGG + Intergenic
1008359395 6:50597725-50597747 CTCTTATTCTGACCTCTGAAGGG - Intergenic
1009333050 6:62448970-62448992 TTCTGCATCTAACCTAATAAAGG + Intergenic
1013915171 6:115328555-115328577 CTCTGTATGTAACCTATGAATGG + Intergenic
1014016542 6:116537442-116537464 TTCTGAATATAATTTCTAAATGG + Intronic
1014425838 6:121304943-121304965 TTCTGACTCTAGTTTCTGAATGG - Intronic
1015687140 6:135877394-135877416 ATCTGAAACTGACATCTGAATGG - Intronic
1017252459 6:152296028-152296050 TTCATAATCCAACTTCTGAAAGG + Intronic
1018181488 6:161227184-161227206 TTCTGAATCTCCACCCTGAAAGG - Intronic
1018958024 6:168425565-168425587 TACTGAATTTAACAACTGAAAGG + Intergenic
1024518675 7:50283859-50283881 TTCTCCTTCTAACTTCTGAAAGG - Intergenic
1030329630 7:108257411-108257433 CTATGAATGTATCCTCTGAAAGG - Intronic
1035010303 7:155709888-155709910 TTCTAAAACTAATCTGTGAATGG - Intronic
1035898700 8:3434216-3434238 TTCAGAATATTACCTCTGTAAGG + Intronic
1036001973 8:4615925-4615947 TTCTTAATCTAAGTTTTGAAAGG - Intronic
1036287258 8:7454200-7454222 TTCTGAATGTATCCTGTGCATGG + Intronic
1036334223 8:7857325-7857347 TTCTGAATGTATCCTGTGCATGG - Intronic
1036480699 8:9136856-9136878 TTCTGGATCTTCCCTCTCAATGG - Exonic
1039896224 8:41718625-41718647 CTCTGAATGTAAACTCTGAAGGG + Intronic
1039959755 8:42237426-42237448 TGTTGCATCTAAACTCTGAAAGG + Intergenic
1040949326 8:52920301-52920323 TTTAGAAACTAATCTCTGAAGGG - Intergenic
1042756277 8:72215867-72215889 GCCTGAATCTAAGCTCTGAAAGG + Intergenic
1042768356 8:72352259-72352281 TTCTGGATCTAGCCACTCAATGG + Intergenic
1046051932 8:109033717-109033739 TTCTGACTCTAATTTCTGAATGG + Intergenic
1046237233 8:111441071-111441093 GTATGAATAAAACCTCTGAAGGG - Intergenic
1047741020 8:127807129-127807151 TTCTCAATCTTACCTAGGAACGG - Intergenic
1048309274 8:133305977-133305999 TTCTGAAGCTAAAGTCTAAATGG + Intergenic
1048661101 8:136602153-136602175 TTCTTCATCTAACCTAGGAATGG + Intergenic
1050211197 9:3258594-3258616 TTCAGAAGGTAACATCTGAATGG - Intronic
1051000509 9:12276337-12276359 ATCTGAGTCTAACATTTGAAAGG + Intergenic
1051071320 9:13171486-13171508 TTCTGTATCTAATCAGTGAAGGG + Intronic
1052892980 9:33720687-33720709 TGCTGAAACTTCCCTCTGAAAGG + Intergenic
1053025190 9:34723603-34723625 TTCTGAAGCTAGACTCTGTAAGG + Exonic
1053036719 9:34832666-34832688 TTCTGAAGCTAGACTCTGTAAGG + Intergenic
1053803986 9:41783483-41783505 TTCTGTCTCTAACCACTGAAAGG + Intergenic
1054141294 9:61531974-61531996 TTCTGTCTCTAACCACTGAAAGG - Intergenic
1054192289 9:61994981-61995003 TTCTGTCTCTAACCACTGAAAGG + Intergenic
1054460986 9:65462412-65462434 TTCTGTCTCTAACCACTGAAAGG - Intergenic
1054646117 9:67593710-67593732 TTCTGTCTCTAACCACTGAAAGG - Intergenic
1055582181 9:77717956-77717978 TTCTGAATTTAAGCTCTGTAAGG + Exonic
1056570468 9:87810289-87810311 TTCTGCACCTCACCTCTTAACGG - Intergenic
1060528930 9:124336512-124336534 TTCTGAGTCCAGCCCCTGAATGG + Intronic
1185639984 X:1584585-1584607 TTCTGACTCTGCCCTTTGAAAGG - Intergenic
1188176453 X:26996497-26996519 TTCTGCCTCTAACTTCTGACAGG + Intergenic
1188232615 X:27683827-27683849 TGCTGAAGCTATCCTCTGAGGGG + Intronic
1188257651 X:27981891-27981913 TGCTGAAGCTATCCTCTGAGGGG - Intergenic
1194278298 X:91914122-91914144 TTCTGAGTCTAGCCACTGAGTGG - Intronic
1199799934 X:151240488-151240510 TTCTGAATATCAGCTCTGCAAGG - Intergenic
1200595633 Y:5136198-5136220 TTCTGAGTCTAGCCACTGAGTGG - Intronic