ID: 914564582

View in Genome Browser
Species Human (GRCh38)
Location 1:148853526-148853548
Sequence CTTCTGAATCTAACCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564582_914564587 16 Left 914564582 1:148853526-148853548 CCTTCAGAGGTTAGATTCAGAAG No data
Right 914564587 1:148853565-148853587 TATTTTTAGAACCTAGATCTGGG 0: 4
1: 0
2: 2
3: 24
4: 346
914564582_914564586 15 Left 914564582 1:148853526-148853548 CCTTCAGAGGTTAGATTCAGAAG No data
Right 914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG 0: 4
1: 0
2: 0
3: 18
4: 288
914564582_914564583 -10 Left 914564582 1:148853526-148853548 CCTTCAGAGGTTAGATTCAGAAG No data
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564582 Original CRISPR CTTCTGAATCTAACCTCTGA AGG (reversed) Intronic
No off target data available for this crispr