ID: 914564583

View in Genome Browser
Species Human (GRCh38)
Location 1:148853539-148853561
Sequence GATTCAGAAGTACCTCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564579_914564583 15 Left 914564579 1:148853501-148853523 CCTTTGCTGGGATAAATTTGTAT No data
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data
914564581_914564583 -9 Left 914564581 1:148853525-148853547 CCCTTCAGAGGTTAGATTCAGAA 0: 4
1: 0
2: 2
3: 18
4: 172
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data
914564578_914564583 20 Left 914564578 1:148853496-148853518 CCTTGCCTTTGCTGGGATAAATT 0: 4
1: 0
2: 0
3: 25
4: 221
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data
914564582_914564583 -10 Left 914564582 1:148853526-148853548 CCTTCAGAGGTTAGATTCAGAAG No data
Right 914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564583 Original CRISPR GATTCAGAAGTACCTCCTTT AGG Intronic
No off target data available for this crispr