ID: 914564586

View in Genome Browser
Species Human (GRCh38)
Location 1:148853564-148853586
Sequence TTATTTTTAGAACCTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 4, 1: 0, 2: 0, 3: 18, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914564584_914564586 -10 Left 914564584 1:148853551-148853573 CCTCCTTTAGGAATTATTTTTAG 0: 4
1: 0
2: 2
3: 35
4: 350
Right 914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG 0: 4
1: 0
2: 0
3: 18
4: 288
914564582_914564586 15 Left 914564582 1:148853526-148853548 CCTTCAGAGGTTAGATTCAGAAG No data
Right 914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG 0: 4
1: 0
2: 0
3: 18
4: 288
914564581_914564586 16 Left 914564581 1:148853525-148853547 CCCTTCAGAGGTTAGATTCAGAA 0: 4
1: 0
2: 2
3: 18
4: 172
Right 914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG 0: 4
1: 0
2: 0
3: 18
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914564586 Original CRISPR TTATTTTTAGAACCTAGATC TGG Intronic
901125655 1:6926740-6926762 TTTTTTTTTGAAACAAGATCTGG + Intronic
902891134 1:19444514-19444536 TTATGTTTATAATCTAGATGGGG - Intronic
905969286 1:42129038-42129060 TTTTTTTCAAAACATAGATCTGG + Intergenic
906385733 1:45367120-45367142 TTATTTTTTGAGACTAGGTCTGG - Intronic
907465751 1:54635412-54635434 TTATGTTTAGCTCCTAGAGCGGG - Exonic
907678701 1:56543002-56543024 TTTTTTTTTGAAACAAGATCTGG - Intronic
908266916 1:62388295-62388317 TTATTTTTAGAAACAGGGTCTGG - Intergenic
909908968 1:81236705-81236727 TGATTTTTAGATCATAGATGAGG + Intergenic
910522989 1:88144714-88144736 TGATTTTGAAAACCTAGATATGG + Intergenic
911583858 1:99667734-99667756 TTTGTTCTAGAACCTGGATCTGG - Exonic
911728053 1:101263248-101263270 TTAATTTTAGAGCCAATATCAGG - Intergenic
911864505 1:103000260-103000282 TTATTTTTAATATTTAGATCAGG - Intronic
911892308 1:103386980-103387002 TTATTTTTTGAACCAACATGTGG + Intergenic
911935938 1:103971823-103971845 TAATTTTAAAAACCTAGATTTGG + Intergenic
913582657 1:120242071-120242093 TTATTTTTAGAACCTAGATCTGG + Intergenic
913625516 1:120656289-120656311 TTATTTTTAGAACCTAGATCTGG - Intergenic
914564586 1:148853564-148853586 TTATTTTTAGAACCTAGATCTGG + Intronic
914608240 1:149276678-149276700 TTATTTTTAGAACCTAGATCTGG - Intergenic
915180288 1:154053013-154053035 TTATGTTTAGCCCCTAGAGCGGG - Intronic
915942262 1:160125812-160125834 TTATCTCTAGAACCCAGAACAGG - Intronic
916868994 1:168891938-168891960 TTATTTTTAGAAGCTTTATCGGG - Intergenic
916911158 1:169348299-169348321 TTATTTTTAAAAACTTAATCAGG - Intronic
917799211 1:178554947-178554969 TTATGTTTAGCTCCTAGAGCAGG + Intergenic
918901117 1:190419473-190419495 ATATTTTTAGAACCAAGTTTAGG - Intronic
918963796 1:191313819-191313841 ATATTTTTATAACCTATATGTGG + Intergenic
919023160 1:192134953-192134975 TTACTTTAAGAAACTAAATCTGG + Intergenic
919055353 1:192563717-192563739 TTATTTTTAGAGACAGGATCTGG - Intergenic
920452697 1:206072019-206072041 TTTTTTTTAGAACCTGTCTCAGG + Intronic
922136049 1:222827645-222827667 TTATTTCTAGAACTGAGGTCAGG + Intergenic
922510938 1:226166785-226166807 TTATTTTTACAACCTAATTCAGG - Intronic
1063124547 10:3127124-3127146 CTATTTTTAGAAGCTAATTCAGG + Intronic
1063651505 10:7942358-7942380 TTATTTATAGAACTTATCTCTGG + Intronic
1063654936 10:7979028-7979050 TTATTTTTAGAGACAGGATCTGG - Intronic
1065478649 10:26169548-26169570 TCATTTTTAGATGCTAGATTTGG + Intronic
1065719102 10:28608176-28608198 TTTTATTTAGAATCTACATCAGG + Exonic
1067282642 10:44883957-44883979 TTGGTCTTTGAACCTAGATCTGG - Intergenic
1068238716 10:54274504-54274526 GTATTTTCAGAGCCTAGAACAGG + Intronic
1068493553 10:57755477-57755499 TTATTTTTGTAACCTTGAACAGG - Intergenic
1068893860 10:62178458-62178480 TAGTATTTAGAACCAAGATCTGG + Intergenic
1071766073 10:88666899-88666921 TTATTTTGAGAGCCCAGATTTGG - Intronic
1078710909 11:13790069-13790091 TTATTTTTAAATCACAGATCTGG - Intergenic
1078789627 11:14529256-14529278 TTATGTTTAGCACCTATAACTGG + Intronic
1080204031 11:29708198-29708220 TTATTTCTAGAACCTGAAGCAGG - Intergenic
1080525507 11:33112773-33112795 TTATTTTTAGAATTTAAACCAGG - Intronic
1081426358 11:42930412-42930434 TTATTTTTAGAAACTCCAACTGG - Intergenic
1086202455 11:84220059-84220081 TTATTTTTAGCAGCTATGTCAGG - Intronic
1087308317 11:96509522-96509544 AAAGTTTTAGAACCTATATCAGG + Intergenic
1087468666 11:98543939-98543961 TTTTTTTTACAATCTAGTTCTGG - Intergenic
1087518198 11:99194509-99194531 TGATTATGAGAACCTAGATCTGG + Intronic
1092974203 12:13728442-13728464 TTATTTTTAAAACATATATAAGG - Intronic
1095566658 12:43632318-43632340 TTATTTTTAAAATGCAGATCTGG + Intergenic
1095825451 12:46525887-46525909 TTATTTTTAGCATCTCAATCTGG - Intergenic
1098299938 12:69043769-69043791 TTATTTATAGAATGTAGATTAGG + Intergenic
1099466235 12:82991375-82991397 TTATTTTTAGAAACTATCTTTGG + Intronic
1099638200 12:85244131-85244153 TTATTTTTGGCACTTAGATTCGG + Intronic
1099770056 12:87040841-87040863 TTATTTATAGAGCCTATATTTGG + Intergenic
1100793980 12:98160458-98160480 TTCTATTTAGAACCCAGATGAGG - Intergenic
1100814350 12:98371619-98371641 TTATTTTTAGTAACTAGCCCAGG - Intergenic
1101501022 12:105303711-105303733 TTATGTTTAGCTCCTAGAGCGGG + Intronic
1101590699 12:106122679-106122701 TTATTTTGAGAACACAGCTCTGG - Intronic
1101932264 12:109024267-109024289 TTATTTTTTGAGACAAGATCTGG + Intronic
1103543784 12:121685199-121685221 TTCTTTTTAAAACAAAGATCAGG - Intergenic
1104180045 12:126370678-126370700 TTGTTTTAAGAACCTATAACAGG - Intergenic
1104642708 12:130477772-130477794 TTATTTTGAGATCCAAGACCTGG + Intronic
1105206096 13:18225845-18225867 TTATTTTTAACACCTATATTGGG + Intergenic
1105343629 13:19552376-19552398 TTATTTTTAGATGCTTGATAAGG - Intergenic
1105375931 13:19844296-19844318 TTATTTTTTGAAACAAGGTCTGG - Intronic
1105536413 13:21269258-21269280 TTATTTTTAGATGCTTGATAAGG + Intergenic
1106742331 13:32658424-32658446 TTATTTTTAGAACATTGCTTGGG + Exonic
1107067342 13:36228873-36228895 TTATTTTCAGAGCTTAGAACTGG + Intronic
1107282459 13:38752389-38752411 TTGTTTTTAAAATCTAAATCAGG - Intronic
1108672140 13:52702155-52702177 TTATTTTTAGAACCCAGTACAGG + Intergenic
1109547840 13:63850376-63850398 ATATTTTTAGAATCTTGATTTGG - Intergenic
1112269725 13:97957494-97957516 TCATTTAAAGAACTTAGATCAGG - Intronic
1115322701 14:32101617-32101639 TTCTTTCAAGAACCTAAATCAGG - Intronic
1116300140 14:43169391-43169413 TTATTTTTAGAAGATAAATTGGG + Intergenic
1116829860 14:49707831-49707853 TTTTTTTTAGAGACAAGATCTGG + Intronic
1117872453 14:60215476-60215498 TTAGTTTTAAAACCAGGATCAGG + Intergenic
1118410874 14:65476248-65476270 TTATTTTTTCATCATAGATCAGG + Intronic
1118487875 14:66231088-66231110 GAATATTTAGAATCTAGATCAGG - Intergenic
1119294041 14:73518871-73518893 TTATTTTTAGTACGTAGAAAGGG + Intronic
1120787240 14:88549076-88549098 ATGTTTCTAGAACCTCGATCTGG + Intronic
1120820979 14:88911634-88911656 TTATTTTTAGAGCCTAGAATGGG - Intergenic
1121133734 14:91474776-91474798 TAATTTTTAAAACTTAGATATGG - Intronic
1121672051 14:95717750-95717772 TTTTTTTTAGTTCCTAGGTCTGG + Intergenic
1123711964 15:22994939-22994961 TTATTTTTAAAATATAGATGGGG - Intronic
1124475333 15:30028347-30028369 TTACTATTACAACCCAGATCTGG + Intergenic
1124555497 15:30721291-30721313 TTATTTTAAGTCCCTAAATCTGG + Intronic
1124675763 15:31684404-31684426 TTATTTTAAGTCCCTAAATCTGG - Intronic
1124878394 15:33618265-33618287 TTATTTTTATAAATTAGAGCTGG - Intronic
1125696716 15:41643956-41643978 TTACTTTTAGATCTTTGATCTGG + Intronic
1126163949 15:45638030-45638052 TTATTATTACCACCTACATCTGG - Intronic
1126648409 15:50897718-50897740 TTATTTTTAGAATATATCTCTGG - Intergenic
1126704525 15:51395172-51395194 TTATACTTAGATCCCAGATCTGG - Intronic
1127504662 15:59586580-59586602 TTATTTTTAGATAGTAGATAGGG + Intergenic
1127548514 15:60013987-60014009 TTACTTTTAGAACCTGACTCTGG - Intronic
1129090058 15:73139923-73139945 TTCTTTGTAAAACCTACATCAGG - Intronic
1129434492 15:75527467-75527489 CTGTTTTCTGAACCTAGATCTGG - Intronic
1130229999 15:82089467-82089489 TTATTTTTTGAGTCAAGATCAGG - Intergenic
1131477015 15:92748505-92748527 TTTTTTTTAGAGATTAGATCTGG - Intronic
1132184406 15:99791398-99791420 TACTTTTAAGAACCAAGATCAGG - Intergenic
1132432573 15:101773268-101773290 TACTTTTAAGAACCAAGATCAGG + Intergenic
1133953458 16:10418799-10418821 TTATGTTTAGCTCCTAGAGCGGG + Intronic
1134006796 16:10823283-10823305 TTATTTTTATTTGCTAGATCTGG - Intergenic
1136482347 16:30550154-30550176 TTATTTTTGGAACCTGTCTCAGG - Intronic
1137332112 16:47508103-47508125 GTATTTTTAGAAAATACATCAGG - Intronic
1137339362 16:47584809-47584831 TTATTTTTTGAGTCTAGATGAGG + Intronic
1137551206 16:49438770-49438792 TGATTTTTAGAAAATACATCTGG - Intergenic
1137754484 16:50890581-50890603 TTATTTTTAGCAAATAGATTTGG + Intergenic
1137937479 16:52648344-52648366 ATCATTTGAGAACCTAGATCAGG + Intergenic
1138440286 16:57030216-57030238 TTACCTTCAGAACCTAGCTCAGG + Intronic
1141990540 16:87606774-87606796 TCATTATTAGAACCAACATCTGG + Intronic
1143710644 17:8732570-8732592 TTATTATGAGAACATAGCTCAGG - Intronic
1145848404 17:28065567-28065589 TTATTTTTAGAAGGTGGCTCAGG + Intronic
1146038411 17:29428645-29428667 TTATTTTTTGAGACAAGATCTGG + Intronic
1146798479 17:35799751-35799773 GTATTTATAGGCCCTAGATCTGG - Intronic
1152184824 17:78848917-78848939 TTATTTTTTAAAGTTAGATCAGG + Intergenic
1152391588 17:80006962-80006984 TTATTTTTAAAAAGTAGATATGG - Intronic
1153068031 18:1069702-1069724 TTATTTCTAGAAGCTTGATTTGG + Intergenic
1153170071 18:2306015-2306037 TGAAATTTAGGACCTAGATCGGG + Intergenic
1155099695 18:22597932-22597954 TAAATTTTAAAACCTAGATGAGG - Intergenic
1156665270 18:39397591-39397613 TTATTTTAATAACCAAAATCTGG + Intergenic
1157962824 18:52175837-52175859 TTATTTTTATAACATAGTTGGGG - Intergenic
1158651334 18:59289483-59289505 TTAATTTTAGAATCTAGATGGGG - Intronic
1160224803 18:77004363-77004385 TTTTTTTTAAAAGCAAGATCAGG + Intronic
1160500446 18:79399210-79399232 GTATTATTAGAAACTAAATCAGG + Intronic
1161025101 19:2033191-2033213 TTATTATTAGAACCTAAACTAGG + Intronic
1162213130 19:9109183-9109205 TTATTTTTAGAGACAGGATCTGG + Intergenic
1164840046 19:31386489-31386511 TTAATTTTGAAACCAAGATCAGG - Intergenic
1165811015 19:38611766-38611788 TTATTTTTAGAGACAGGATCTGG - Intronic
1165865688 19:38936057-38936079 TTATGTTTAGCTCCTAGAGCAGG + Intronic
1166767617 19:45261611-45261633 TTATTTTTAAAACAGAGATGGGG - Intronic
925549406 2:5054991-5055013 TTATTTTTTTAACATAGATTGGG - Intergenic
926195270 2:10760071-10760093 TTATTTTAAAAAGCAAGATCTGG + Intronic
926476848 2:13333240-13333262 TTATTTTCAGAACAAAGATTTGG - Intergenic
926563388 2:14442574-14442596 TTATTTTTAAAAGCTAAATAAGG - Intergenic
927778989 2:25924322-25924344 TTGTTCTCAGAACCTAGAGCTGG - Intergenic
928752009 2:34481651-34481673 TTATTTTTATATGCTAAATCTGG - Intergenic
928879211 2:36078383-36078405 TTTTTTTTGGAATATAGATCTGG + Intergenic
930468362 2:51781769-51781791 TTTTTTTTAGAACCCATATTTGG - Intergenic
930916997 2:56704499-56704521 TTCTTATAAGAACCTAAATCAGG - Intergenic
931423678 2:62151394-62151416 TTATTTTTAGATGCTTGAACAGG - Intergenic
937565083 2:123275629-123275651 TAATTCTGAGAACATAGATCTGG - Intergenic
940648549 2:156417473-156417495 TTATTTTTAGTAGCTTGTTCAGG - Intergenic
941794936 2:169588659-169588681 TTATTATAAGAACTTAGATCAGG + Intronic
943378296 2:187109562-187109584 TTATTGTGAGAACCTGGATGAGG + Intergenic
944186783 2:196957732-196957754 GTATTTTTAAAACCTTTATCTGG + Intergenic
945044210 2:205767564-205767586 TTTTTTTTATAACCTGGATGAGG - Intronic
946547060 2:220755737-220755759 TTATTTTTATAATATAGATGTGG - Intergenic
947312877 2:228823501-228823523 TTTTCTCTTGAACCTAGATCTGG + Intergenic
948041708 2:234906512-234906534 TTATTTTTAAAAAATTGATCAGG - Intergenic
1169617181 20:7461389-7461411 TTACCTTTGGAACCTACATCTGG - Intergenic
1172139900 20:32715154-32715176 TTATTTTTTGAGACTAGGTCTGG - Intronic
1173541310 20:43853647-43853669 TGATATTTACAACCAAGATCTGG + Intergenic
1173803589 20:45910271-45910293 TCATTTTTAACACCTGGATCAGG - Intronic
1174603293 20:51741962-51741984 TTATATATAAAACCTAGAGCAGG - Intronic
1174713865 20:52735883-52735905 TTATTTTTAGTCACTAAATCTGG + Intergenic
1176661625 21:9641038-9641060 TTATTTTTAGGACCAACATGAGG + Intergenic
1177215688 21:18124984-18125006 TTTTTTTGAGATCCTAGACCTGG - Intronic
1177670406 21:24217825-24217847 TTATTTTAATAACCTTCATCAGG + Intergenic
1179072580 21:38085634-38085656 TCAAATTTAGAACCAAGATCTGG + Intronic
1180611333 22:17100128-17100150 TTTTTTTTTAAACCTGGATCTGG - Intronic
1180759867 22:18192869-18192891 TTATTTTTAACACCTATATTGGG - Intergenic
1180770179 22:18377171-18377193 TTATTTTTAACACCTATATTGGG - Intergenic
1180775801 22:18431831-18431853 TTATTTTTAACACCTATATTGGG + Intergenic
1180776151 22:18485495-18485517 TTATTTTTAACACCTATATTGGG + Intergenic
1180808875 22:18742866-18742888 TTATTTTTAACACCTATATTGGG + Intergenic
1180828120 22:18880125-18880147 TTATTTTTAACACCTATATTGGG - Intergenic
1181194872 22:21176788-21176810 TTATTTTTAACACCTATATTGGG + Intergenic
1181214573 22:21315986-21316008 TTATTTTTAACACCTATATTGGG - Intergenic
1181524974 22:23477223-23477245 TTATTTTTAACACCTATATTGGG - Intergenic
1203232011 22_KI270731v1_random:118355-118377 TTATTTTTAACACCTATATTGGG - Intergenic
1203278218 22_KI270734v1_random:106125-106147 TTATTTTTAACACCTATATTGGG - Intergenic
951976645 3:28517831-28517853 TAATTTTTAAAAACTAGATATGG + Intronic
952041950 3:29271427-29271449 GTATTTTTATAGCCTAAATCTGG - Intergenic
952062954 3:29532715-29532737 CTATTTTTAGAGACTGGATCTGG - Intronic
952173757 3:30838906-30838928 TTATTCTCAGAAACTAGATGTGG - Intronic
952992563 3:38844432-38844454 TTTTTTTTAGAAACTTGATAGGG + Intergenic
953195246 3:40726287-40726309 CTATTTTTAGTACCTAGAAAAGG + Intergenic
953847777 3:46442384-46442406 TTATATCTAGAATCTAGATTGGG - Intronic
954710390 3:52502532-52502554 GTATTTTTAGAACTCAGCTCGGG - Intronic
955337098 3:58095796-58095818 TTATTTTTAGTACCTAACACTGG + Intronic
955582351 3:60437792-60437814 ATATTTTTAGAATATAGGTCTGG - Intronic
957408659 3:79807497-79807519 TTATTTTAGGCAGCTAGATCAGG - Intergenic
957435329 3:80167966-80167988 TTCTGTTTAGAAGCTAGATCTGG + Intergenic
958532089 3:95346698-95346720 TGGTTTTTAAAACCAAGATCTGG - Intergenic
959216614 3:103457808-103457830 TTTTATTTATAACCTAGATTTGG + Intergenic
959582405 3:107994949-107994971 TTATTCTTAGAACCTGGGTAAGG + Intergenic
960327445 3:116314796-116314818 TCATTCTTAGAACCTATATATGG - Intronic
961643045 3:128376827-128376849 TTAATGTCAGAACCTAGGTCAGG + Intronic
962231226 3:133667163-133667185 TTTTTTTTAGAGACAAGATCTGG - Intergenic
962585233 3:136836028-136836050 GGATTTTTAGAACCAAGATCTGG + Intronic
963036315 3:141032237-141032259 TTATTTTTAGAATGTATATAAGG - Intergenic
966447054 3:180012580-180012602 TTTTTTGTAGTACCTAGACCAGG - Intronic
967326653 3:188247283-188247305 CTATTTTTAGAGCCTTCATCTGG + Intronic
968144001 3:196282747-196282769 TTATTTTTTGACCGTAGAACAGG - Intronic
970671360 4:18400269-18400291 TTGTTTTTGGAACCTATATGAGG + Intergenic
970687263 4:18582745-18582767 TTAGTTTTAGAACCTAATTTAGG - Intergenic
970702636 4:18760947-18760969 TGATTTGTCGAACCTTGATCAGG + Intergenic
973659619 4:53089795-53089817 TTAGTTTTGGAATCTACATCTGG + Intronic
973845918 4:54913152-54913174 TTTTTTTTAGACCCTAGAAAAGG + Intergenic
974510892 4:62839090-62839112 TTATTTTTAGAGCATATATATGG - Intergenic
974722684 4:65762571-65762593 TTATTTTGAGATTCTAGATTGGG - Intergenic
975269191 4:72409350-72409372 TTAATTTAAGAATCAAGATCTGG + Intronic
976915709 4:90372450-90372472 TCATTTTTAAAAGCTAGATTAGG + Intronic
977532161 4:98212745-98212767 TTATTTTTAGAGACAAGGTCTGG - Intergenic
978218630 4:106240857-106240879 TTAATTATAGAATCTAGGTCAGG + Intronic
978261943 4:106770296-106770318 TTATTTTGAGAACCAACATATGG - Intergenic
979557506 4:122066409-122066431 TTATTTTTAAAACATAGATTGGG - Intergenic
979784799 4:124702619-124702641 ATAATTATAGAACCTAGATAAGG + Intronic
980667227 4:135955714-135955736 TTATGTTTAGCTCCTAGAGCGGG + Intergenic
981078682 4:140616892-140616914 TTATTTTTAAAGCCTTGATTGGG + Intergenic
982808402 4:159795017-159795039 TTATTTTTATACCCTATATTAGG - Intergenic
983155866 4:164347636-164347658 TTATTTTGAGAACTAAGATTAGG - Intronic
983601368 4:169533016-169533038 ATAATTTTAGAGCCTACATCTGG - Intronic
983846114 4:172521430-172521452 TTATATTTAGATCATAGTTCTGG - Intronic
984170193 4:176349854-176349876 TTATGTTTAGCTCCTAGAGCGGG - Intergenic
985191323 4:187376513-187376535 TTACTTTAAGAACCTAGGTTGGG - Intergenic
986327655 5:6688663-6688685 GTATTTTTAAAAACTTGATCAGG + Intergenic
986361237 5:6980158-6980180 TTATTTTGTGAACCAAGGTCAGG - Intergenic
987140554 5:14941445-14941467 ATTTTTTTAAAACCAAGATCTGG - Intergenic
988037224 5:25842790-25842812 TTTTTTGTAGAAACAAGATCTGG + Intergenic
988134260 5:27149427-27149449 TTATTTTTAGGACCTTAGTCTGG - Intergenic
988650987 5:33150546-33150568 TAATTTTTAAAAATTAGATCAGG - Intergenic
988668411 5:33355197-33355219 TTAATTTTAGAAACTCTATCAGG + Intergenic
989009887 5:36858078-36858100 TTATTTTTAGAGACAGGATCTGG + Intergenic
990550164 5:56867971-56867993 ATATTATTATAACCTAGATTTGG - Intronic
991990452 5:72333488-72333510 TTATTCTCAGCACCTAGAACAGG + Intronic
994544653 5:101149486-101149508 TTATATTGAGAACCTAAATTTGG + Intergenic
994654084 5:102567605-102567627 TTATTTTTAAAAAGTAGAGCAGG - Intergenic
995563134 5:113404474-113404496 TTGCTTTTATATCCTAGATCTGG - Intronic
996175875 5:120356307-120356329 TTATTTTTAAAAATTAGATTTGG - Intergenic
997573301 5:134951055-134951077 TAATTTTTAAAAAATAGATCAGG + Intronic
998787272 5:145726598-145726620 CTATTTTTAGGACCAGGATCAGG + Intronic
998862319 5:146456522-146456544 TATTTTATATAACCTAGATCTGG + Intronic
1000369057 5:160517545-160517567 TCCTTTTTAGAACCTAGTTCTGG + Intergenic
1004214721 6:13691595-13691617 TTATTTTAAAAACTGAGATCTGG + Intronic
1004868785 6:19881808-19881830 TAATATTTAGAACCAAGATATGG - Intergenic
1007372779 6:41437643-41437665 TTATTTTTAGAGACAGGATCTGG + Intergenic
1009443032 6:63705220-63705242 TTATTACTAGAACCTAAAACAGG - Intronic
1009649717 6:66459475-66459497 ATATTTTTAAAATCTAGATGAGG - Intergenic
1009811032 6:68667085-68667107 TTATATATAGAACATAGAGCTGG + Intronic
1010872150 6:81056792-81056814 TTTCATATAGAACCTAGATCAGG - Intergenic
1011676302 6:89737454-89737476 ATAAATTTAGAACCCAGATCTGG - Intronic
1011739948 6:90349647-90349669 TTATTTTTAGAGACAAGGTCTGG + Intergenic
1012503008 6:99911041-99911063 TTATCTTTAAAACCCACATCTGG + Intergenic
1013143978 6:107369117-107369139 TTATTTTTAAAACACAGAACAGG + Intronic
1013401368 6:109800009-109800031 TTATTGTGAGAACTTAGAACAGG - Intronic
1014097836 6:117479661-117479683 TTATTATTAGATCATAAATCAGG + Intronic
1014894026 6:126878174-126878196 TTTTTTTTAGAACTTACAGCAGG - Intergenic
1017426624 6:154328567-154328589 TTCTTTTTAGAAAATAGATTTGG - Intronic
1018361248 6:163071686-163071708 TTTTTTTTCTAACTTAGATCTGG - Intronic
1018373529 6:163189932-163189954 TTATTTCTATAAGCTAGGTCTGG + Intronic
1020661444 7:10988545-10988567 TTTTTTTTTTAACCTAGATGTGG + Intronic
1023336590 7:39177100-39177122 TTATTTTTAGAATGAAAATCAGG + Intronic
1026219221 7:68377944-68377966 TTATTTCTAGAACATTCATCAGG - Intergenic
1027541114 7:79466700-79466722 TTATATTTAGAAAGAAGATCTGG + Intergenic
1027829427 7:83159256-83159278 TTCTCTTTAGAACCTGGATTTGG + Intronic
1027978742 7:85189439-85189461 TTATTTTAAGAATTTAGATAGGG - Intergenic
1028045619 7:86114862-86114884 TTATTTTTAGAAACTTTAACTGG + Intergenic
1028260158 7:88654437-88654459 TTATTTTCAGAGCCTGGATCAGG + Intergenic
1028812677 7:95105873-95105895 TTAGTATTAGAACATAGATTAGG - Intronic
1028838739 7:95402879-95402901 TTATTTTTAAAAACAAAATCAGG - Intergenic
1031174577 7:118334213-118334235 TTAATTTAAGAACTTAGATGAGG - Intergenic
1031194785 7:118599565-118599587 CTATCTTTAAAACCTAGATCAGG - Intergenic
1033046835 7:137969889-137969911 TTATTTTTACAACCTTTCTCAGG + Intronic
1033347145 7:140534382-140534404 TTGTTTTTAGAACATTGATGTGG - Intronic
1036926850 8:12915468-12915490 TTATTTTAAAAACCTATATTTGG + Intergenic
1038884790 8:31651419-31651441 TTATTTTTACAATGTAGATGGGG + Intronic
1039025651 8:33255116-33255138 TTATCTCTAGAACCTAGCACAGG - Intergenic
1039397317 8:37237501-37237523 AGATTTTTAGAACCTATACCTGG - Intergenic
1040930817 8:52733454-52733476 TATTTTTTAGAACCTGGACCGGG - Intronic
1041819384 8:62012579-62012601 TTATATTTATAACATAAATCTGG + Intergenic
1042034852 8:64521508-64521530 TTTTTTTTTTAACCTCGATCTGG - Intergenic
1042093154 8:65181120-65181142 TTATTTTTTGAAACAAGGTCTGG - Intergenic
1042943475 8:74131280-74131302 ATCATTTGAGAACCTAGATCTGG - Intergenic
1043402804 8:79900372-79900394 TTATTTTTTGAGACTAGATCTGG - Intergenic
1043962336 8:86431561-86431583 ATATTTTTAGTACCTAGAAAAGG + Intronic
1044152371 8:88797437-88797459 TTATTTTTAAAACTTAGAGGAGG + Intergenic
1044773899 8:95667462-95667484 TTATTTTTATGACCTAGCTTTGG + Intergenic
1044985172 8:97750737-97750759 ATTTTTTTAGTACCTAAATCAGG - Intergenic
1045482166 8:102601199-102601221 TTATTTTTAAACCCTGGATCGGG - Intergenic
1047559856 8:125974925-125974947 TTATTTTTAAAAGCCATATCAGG - Intergenic
1047653414 8:126949035-126949057 TGTTATTTAGAACCTAGATTTGG + Intergenic
1047686500 8:127310008-127310030 TTCCTTTTAAAACCTAGAGCAGG - Intergenic
1048655593 8:136532187-136532209 TTATTTTCAGAGTCTAGATGAGG + Intergenic
1048656387 8:136541800-136541822 TTATTTTTATTACCTAGAACAGG - Intergenic
1049562615 8:143319304-143319326 TAATTTTTAGAGACTAGGTCTGG + Intronic
1050419282 9:5446474-5446496 GTATTTTTAGAACATTCATCAGG + Intergenic
1051705217 9:19872032-19872054 TTAATTTTAGTAACTAGATGGGG + Intergenic
1056012046 9:82342682-82342704 TTATTCTTAAAAACTAGATATGG + Intergenic
1057512591 9:95693130-95693152 ATATTTTTAGAACTTAGGTAGGG + Intergenic
1057840215 9:98480313-98480335 TTTTTTTTAGAGACTAGATTGGG + Intronic
1058001114 9:99866458-99866480 TTATTTTTAGCACTCATATCTGG - Exonic
1058443097 9:105028635-105028657 TTATTTTAAGAGTCAAGATCTGG + Intergenic
1059740967 9:117149316-117149338 TTATTTTAAGAAACTGGTTCAGG - Intronic
1203639187 Un_KI270750v1:142881-142903 TTATTTTTAGGACCAACATGAGG + Intergenic
1186605543 X:11086112-11086134 TTATTCTTAGAATCTGGGTCGGG - Intergenic
1188508382 X:30907730-30907752 TTATTTAGAGAACCTAGGTGGGG - Intronic
1189514144 X:41694295-41694317 TGATTTTGAGAACCTTGCTCTGG + Intronic
1190824021 X:54000457-54000479 TTATTTATAGAGCCTAAATCTGG - Intronic
1191149323 X:57203906-57203928 TTATGTTTAGCTCCTAGAGCAGG + Intergenic
1191897971 X:66013734-66013756 ATCTTTCTAGAAGCTAGATCTGG + Intergenic
1192303442 X:69931499-69931521 TTGTTTTTAGAGACAAGATCTGG - Intronic
1195965323 X:110424855-110424877 TTATTTTGAGGTCCTTGATCTGG - Intronic
1196670591 X:118362897-118362919 TTATTTTTAGTTGCTAAATCTGG + Intronic
1199514352 X:148659174-148659196 ATATTTTTAAAACCTAGATATGG + Intronic
1201700701 Y:16878423-16878445 TTATGTTTAGCTCCTAGAGCGGG - Intergenic
1202375565 Y:24232667-24232689 TTATTTTTAGTATCTAAAACAGG + Intergenic
1202495215 Y:25437452-25437474 TTATTTTTAGTATCTAAAACAGG - Intergenic