ID: 914566566

View in Genome Browser
Species Human (GRCh38)
Location 1:148873233-148873255
Sequence CTTTGTGACCTAAAGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 4, 1: 0, 2: 0, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914566563_914566566 -5 Left 914566563 1:148873215-148873237 CCTGAAAACACCTGATGTCTTTG 0: 4
1: 0
2: 0
3: 14
4: 179
Right 914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG 0: 4
1: 0
2: 0
3: 7
4: 109
914566562_914566566 14 Left 914566562 1:148873196-148873218 CCAATAACTCATGATTGAGCCTG No data
Right 914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG 0: 4
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914566566 Original CRISPR CTTTGTGACCTAAAGATAGT GGG Intronic
909201752 1:72698239-72698261 CTTGGTGACCTCAAGATAATAGG + Intergenic
911137288 1:94454588-94454610 CTCTTTGACCTAGAGATAGTAGG + Intronic
911354889 1:96804028-96804050 TATGGTGACTTAAAGATAGTAGG + Intronic
912314481 1:108654629-108654651 CTTAGTGTCCTAAATATAATAGG - Intronic
912653020 1:111457833-111457855 CTTTGTAACCTAAATATACATGG - Intronic
913400972 1:118432496-118432518 CTCTCTGACCTAATGATACTGGG + Intergenic
913584570 1:120261377-120261399 CTTTGTGACCTAAAGATAGTGGG + Intergenic
913623613 1:120636982-120637004 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG + Intronic
914606253 1:149257007-149257029 CTTTGTGACCTAAAGATAGTGGG - Intergenic
917219091 1:172708402-172708424 CTTAGTGATCTAAAGATACTGGG + Intergenic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
921112222 1:212049821-212049843 TTTTGTGACCTAAATAGACTAGG - Intronic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063402301 10:5758050-5758072 TTTTGTGACATCAAGATGGTAGG - Intronic
1065633584 10:27707990-27708012 CTTTGTATCCTTAAAATAGTGGG + Intronic
1079011298 11:16830609-16830631 CTCTGGGACCCAAAGATTGTGGG + Intronic
1081404151 11:42676915-42676937 CTCTGTGACCTTAGGTTAGTGGG - Intergenic
1082094733 11:48120293-48120315 TTTTCTGACATAAAGATAGCAGG - Intronic
1083058893 11:59849010-59849032 CTTTGTGACCCATACAAAGTAGG + Intergenic
1086335281 11:85794521-85794543 TTTTGTGACCTTGAGAAAGTGGG - Intronic
1086667645 11:89503234-89503256 CTCTGTGACCTCATGATATTTGG - Intergenic
1089363189 11:117904448-117904470 CTATGTGCCCTAAAGAGAGCAGG + Intronic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1093949286 12:25146244-25146266 CTTTGTGACTTAAAAATAATAGG - Intronic
1104054105 12:125216255-125216277 CTCTGTGTCCTAAAGGTAGAGGG + Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1107066607 13:36220191-36220213 TTTTGGGACCTAGAAATAGTTGG - Intronic
1109736875 13:66497634-66497656 ATTTGAGACCAAAAGATATTAGG + Intronic
1110209514 13:72954929-72954951 CTCTGTGACCTGCAGATACTGGG - Intronic
1110259626 13:73470881-73470903 GTTAGTGGCCTAGAGATAGTAGG + Intergenic
1113197626 13:107827061-107827083 CTTGGAAACCTAAACATAGTAGG - Intronic
1114788737 14:25631360-25631382 CTTTGGGACTTAAAAATATTTGG - Intergenic
1117306222 14:54476662-54476684 CTGTGAGAAGTAAAGATAGTTGG - Exonic
1118981233 14:70718654-70718676 CTTTGTGACGTAAGGACAATGGG - Intergenic
1125429954 15:39583701-39583723 CTATGTGCCCTAAAAATAGAGGG - Intronic
1126737897 15:51750885-51750907 CGTGCTAACCTAAAGATAGTTGG - Intronic
1129929141 15:79394588-79394610 CTATGGGACCTATAAATAGTGGG - Intronic
1131340655 15:91597744-91597766 ATTTGTGATCTAAAGAAAGCAGG - Intergenic
1133696948 16:8273712-8273734 CTTTTGGACCTAAAAATATTAGG - Intergenic
1134429035 16:14184013-14184035 GATTGTGACCTAAAAACAGTTGG + Intronic
1137888387 16:52131316-52131338 CATTGTGAGCTAAAGGCAGTGGG - Intergenic
1138987952 16:62354169-62354191 CTTTGTTATCTAAGTATAGTTGG + Intergenic
1144608194 17:16686363-16686385 CTTTTTAACCTAAAGAGAGCAGG - Intergenic
1145127910 17:20316966-20316988 CTTTTTAACCTAAAGAGAGCAGG - Intronic
1148609445 17:48954677-48954699 CTCTGTGACCTGCAGATATTGGG - Intergenic
1150205370 17:63401220-63401242 GTCTGTGACCCAAAGCTAGTTGG + Intronic
1155904975 18:31439577-31439599 CTTTGTGAGGTCAAGATAGGTGG + Intergenic
1164030252 19:21397200-21397222 CTTCGTGACCTGAAGATACTGGG + Exonic
1164049161 19:21569149-21569171 CTTTGTGACCTGCAGGTATTGGG - Intergenic
1168351145 19:55676551-55676573 CTCTGTGCCCCACAGATAGTAGG - Intronic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
927572618 2:24173160-24173182 CTCTCTGCCCTAAAGTTAGTGGG + Exonic
930743569 2:54858439-54858461 CTTTAAGATCTAAAGAGAGTTGG + Intronic
930978398 2:57492489-57492511 CTTTGTGAGCTGAAGATAAATGG + Intergenic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
938741188 2:134234080-134234102 CTTTGTGGTCTAAAGAGAGAAGG + Intronic
940843054 2:158607309-158607331 CTTTGTAACCCAAGGATAATAGG + Intronic
941602030 2:167554808-167554830 CTTTGTCTACTAAAGTTAGTAGG - Intergenic
946555891 2:220856674-220856696 CTTTGAGACTAAAGGATAGTTGG - Intergenic
946987868 2:225293162-225293184 CTTTATGACCTACAGATGGAAGG + Intergenic
947172695 2:227326466-227326488 CTTTGAAACCAAAAGATAGAAGG - Intronic
947313446 2:228829099-228829121 CTTTGTCACCTATAGTTTGTTGG + Intergenic
1168901689 20:1370364-1370386 GTTTGAGACCCAATGATAGTGGG - Intronic
1173094079 20:40007501-40007523 CACTTTAACCTAAAGATAGTAGG - Intergenic
1176725490 21:10428384-10428406 CTTTGTAACCTTAAGACGGTGGG - Intergenic
1178330624 21:31687683-31687705 CTTTGTGTCCTGAAGAAACTTGG - Intronic
1178991533 21:37360933-37360955 CTTTGTAACCTTAAGATTCTGGG + Intergenic
954418931 3:50408382-50408404 CTTTGTGTCCCAAAGCTGGTGGG - Intronic
955215045 3:56978157-56978179 CTTTGTCAAATAAAGGTAGTAGG - Intronic
965518500 3:169648401-169648423 TTTTTTGACCTAAAAATACTGGG - Intronic
965811634 3:172596944-172596966 CATTCTGACCTAAAGAGAGTAGG + Intergenic
966114146 3:176441196-176441218 CTCTGTGCCCTGAAGATAATGGG + Intergenic
967043942 3:185719248-185719270 ATTTGTGAGATAAGGATAGTGGG + Intronic
968241765 3:197095428-197095450 CTTTGTGACCTTAATACTGTTGG + Intronic
969320598 4:6410127-6410149 CTTTGGGCTCTAAAGAGAGTGGG - Intronic
973703366 4:53558060-53558082 CTTTGTGATCTACTGATTGTGGG - Intronic
975391980 4:73830938-73830960 TTTTGTGACATAGAGATTGTTGG - Intergenic
977220173 4:94328495-94328517 CTTTGTGACAAAAATATAATAGG - Intronic
978862065 4:113461945-113461967 CTTTGTGCCTTAAAGATGATGGG + Intronic
982267884 4:153556663-153556685 CTGTGTTAGCTAAAGACAGTTGG + Intronic
984267122 4:177508413-177508435 CTTTGTGACCCATACAAAGTAGG + Intergenic
989396297 5:40960579-40960601 CTTTTTGACATAAAGCTAGGAGG + Intronic
995677817 5:114683005-114683027 CTTTTTGACATAATGATACTTGG - Intergenic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
999749244 5:154614447-154614469 CTTTGGGGACTAAAGAGAGTGGG + Intergenic
1000788640 5:165577226-165577248 CTTGGAGACCTGATGATAGTAGG - Intergenic
1001131480 5:169067639-169067661 ACTAGTGACCTAAAGATACTTGG + Intronic
1003953351 6:11139992-11140014 CTTGGAGAACTATAGATAGTTGG + Intergenic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1018245438 6:161818262-161818284 CTTCTTGACCTCAGGATAGTAGG - Intronic
1018649694 6:165982924-165982946 CTTTGTAACTTAAAGAAAATTGG - Intronic
1024014793 7:45303555-45303577 CCTTGTGACCTACAGGTACTGGG + Intergenic
1027403933 7:77838385-77838407 CATTGTGACCTTATGATAATTGG + Intronic
1031320002 7:120312856-120312878 CTTTTTGATCTTAAAATAGTTGG - Intronic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1032136733 7:129286086-129286108 CACTGTGACCTAAAACTAGTTGG - Intronic
1032564001 7:132922066-132922088 CTTTGTGAGCTTAAGAAAGCTGG - Intronic
1033480917 7:141739471-141739493 TTTAGTGACCTAAAGACTGTAGG + Intronic
1036450817 8:8865753-8865775 ATTTGGGACCCAAAAATAGTTGG - Intronic
1036999403 8:13699784-13699806 CTTTGTAACCTAAAGGTAAAAGG - Intergenic
1038444319 8:27592939-27592961 CTTTGTGACCTAAGGAAGGCGGG + Intergenic
1038825851 8:31001118-31001140 TTATGTGAGCTAAATATAGTTGG - Intronic
1044978461 8:97690823-97690845 CTTGGTGATCAAAGGATAGTAGG + Intronic
1045871332 8:106930442-106930464 CTTTGTGAACTTAGGATACTTGG + Intergenic
1047035147 8:120929824-120929846 CTTTGTGACATCCAGATAATTGG - Intergenic
1050253408 9:3769633-3769655 CTTGTTGGCCTAAAGATAGCAGG + Intergenic
1052535718 9:29744057-29744079 CTCTAGGACATAAAGATAGTTGG + Intergenic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1055786589 9:79875705-79875727 CTTTTTGACATTAGGATAGTTGG - Intergenic
1056493790 9:87135677-87135699 CTCAGTGACCAAAATATAGTTGG + Intergenic
1057110797 9:92469119-92469141 TTCTGTGGCCTAAAGTTAGTGGG + Intronic
1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG + Intergenic
1187990554 X:24867354-24867376 CTTTTTGACCTAGAGTTACTCGG + Intronic
1192584323 X:72307514-72307536 TTTTCTGACCTAAATCTAGTCGG + Intergenic
1194394424 X:93363680-93363702 CATTGTGACCCAAATATTGTCGG - Intergenic
1194641937 X:96413082-96413104 CTTTGTGAGCTAAAGGGAGAGGG + Intergenic
1195118122 X:101720287-101720309 CTTTGTCAAATAAAGGTAGTAGG + Intergenic
1199046782 X:143183682-143183704 CTCTTTGACCTAAGGATATTAGG - Intergenic