ID: 914568259

View in Genome Browser
Species Human (GRCh38)
Location 1:148890036-148890058
Sequence ACCTTAACAACCTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 4, 1: 0, 2: 1, 3: 11, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914568259 Original CRISPR ACCTTAACAACCTGTGACCT TGG Intronic
901309661 1:8259283-8259305 ACCTTATCAGCCAGTTACCTGGG + Intergenic
904531196 1:31170857-31170879 CTGTCAACAACCTGTGACCTTGG - Intergenic
905444355 1:38015912-38015934 CTCTGAACAATCTGTGACCTTGG - Intronic
908206950 1:61860154-61860176 CACTTATCAACCTGTCACCTAGG - Intronic
908562470 1:65320470-65320492 TCATTTACAAGCTGTGACCTTGG + Intronic
909974837 1:82033647-82033669 ACCTTAGAAACCTGTGACCTTGG + Intergenic
913586250 1:120278178-120278200 ACCTTAACAACCTGTGACCTTGG + Intergenic
913621936 1:120620191-120620213 ACCTTAACAACCTGTGACCTTGG - Intergenic
914568259 1:148890036-148890058 ACCTTAACAACCTGTGACCTTGG + Intronic
914604566 1:149240213-149240235 ACCTTAACAACCTGTGACCTTGG - Intergenic
922057493 1:222055340-222055362 CTCTTACCTACCTGTGACCTGGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
922476608 1:225911119-225911141 ACTTTAACGACAGGTGACCTTGG - Intronic
1064087988 10:12359949-12359971 ACACTAACATCCTGTGACCTGGG - Intronic
1069666128 10:70161018-70161040 ACCTTTACAACTTTTGATCTTGG - Exonic
1070382758 10:75895945-75895967 TTCTTACTAACCTGTGACCTAGG + Intronic
1070853327 10:79584953-79584975 ACCCTAAGAACCTGTGACTCTGG - Intergenic
1072764706 10:98086063-98086085 CCCTTAAGAAGCTGTGACCAGGG - Intergenic
1073617238 10:105008374-105008396 ACTTTAACAGCCTCTGACCAAGG + Intronic
1075138425 10:119808455-119808477 TTCTTAACTAGCTGTGACCTTGG + Intronic
1077285423 11:1763344-1763366 CCCTTTACCACCTGTGAACTGGG - Intronic
1078346708 11:10556117-10556139 ACTTTAGCTACCTGTGACATTGG + Intergenic
1078614961 11:12856382-12856404 ACATTCACAGCCTTTGACCTGGG - Intronic
1078852358 11:15176303-15176325 ACCTGCACAACCTGTGAGGTAGG + Intronic
1079087176 11:17454750-17454772 CCCTTACCAGCATGTGACCTTGG - Intronic
1080181126 11:29427435-29427457 CCCTTAACTACCTGTTTCCTCGG + Intergenic
1080657534 11:34269466-34269488 AGCTTACCAAGCTGTGGCCTAGG - Intronic
1081501359 11:43669845-43669867 AACCCCACAACCTGTGACCTTGG - Intronic
1082742576 11:56926970-56926992 AAATTAACAACCAGTAACCTGGG + Intergenic
1084390395 11:68872043-68872065 ACCTATTCAACCTGTGACCCAGG + Intergenic
1086908484 11:92444917-92444939 ACTTTAACAAACTGTGGCTTTGG - Intronic
1088585925 11:111360155-111360177 ACCTAGACAGCCTGTGGCCTAGG + Intronic
1089794183 11:120967152-120967174 GCATTCACAACCTGTGTCCTGGG + Intronic
1090375061 11:126282809-126282831 ACCGTGACAACCTGAAACCTGGG - Intergenic
1091852570 12:3712190-3712212 ACTTTGCCACCCTGTGACCTTGG + Intronic
1092127025 12:6081636-6081658 ACCTTAAGAACCACTGACTTAGG - Intronic
1095514491 12:42991038-42991060 CCCTTACCAACATGGGACCTGGG - Intergenic
1095559188 12:43545324-43545346 ACCTTAACAATCTGATTCCTTGG + Intronic
1097312515 12:58136106-58136128 ACCTACTCAACCTGTCACCTAGG + Intergenic
1098284376 12:68893030-68893052 ACCTTATCAACCTGTCATCTAGG - Intronic
1098370157 12:69750224-69750246 ACCTTAACTTCCTGTGAGATTGG + Intronic
1101918799 12:108916209-108916231 CCCTTGAAAACCTGTGACCCAGG - Intronic
1102081884 12:110104910-110104932 ACATTAACCAGCTGTGTCCTTGG + Intergenic
1102112574 12:110375629-110375651 ACCTTCACCACCTGTGATCTTGG - Intronic
1102540865 12:113618110-113618132 ACCGTTACGGCCTGTGACCTGGG - Intergenic
1102712952 12:114944205-114944227 ACATTAGCAAACTGTGCCCTTGG - Intergenic
1103200068 12:119080900-119080922 ATGTTAACATCATGTGACCTTGG - Intronic
1104079505 12:125417669-125417691 ACCTTAGCAACCTGTCTCCCTGG + Intronic
1109897660 13:68714453-68714475 TCTGCAACAACCTGTGACCTGGG - Intergenic
1110820862 13:79914668-79914690 ACCTTAGAAACCTGTGAAGTGGG + Intergenic
1115396806 14:32918105-32918127 ACCTTCACAGGCAGTGACCTAGG + Intergenic
1119040753 14:71272207-71272229 ACCTTCCCAACCTCTGACCCAGG + Intergenic
1119396862 14:74332682-74332704 CCTTTAACAACCAGTGCCCTTGG + Intronic
1120544925 14:85799368-85799390 AAGTTAACTAACTGTGACCTTGG + Intergenic
1123715909 15:23031270-23031292 CCCTTAAGGACCTGTGATCTTGG - Intronic
1127825497 15:62699093-62699115 ACCCTAGGATCCTGTGACCTGGG + Intronic
1136071282 16:27788877-27788899 ACCTTCTCCACTTGTGACCTTGG - Exonic
1138483482 16:57319500-57319522 CCCTTATCAACCTGTCATCTTGG - Intergenic
1138740153 16:59298868-59298890 ACCTTAAGAACCTGCGACACAGG + Intergenic
1142680146 17:1542735-1542757 ACCTTGAAAAGGTGTGACCTGGG + Intronic
1147816922 17:43216954-43216976 ATCTTTACAATATGTGACCTTGG + Intronic
1149232058 17:54545729-54545751 CACCTATCAACCTGTGACCTAGG - Intergenic
1158298888 18:56030216-56030238 ACCTCACCAACCTGTCAACTTGG - Intergenic
1159448789 18:68573854-68573876 ACCTTATCAACCCATGACCTAGG - Intergenic
1160367390 18:78338452-78338474 ATCTTTACAACATGTGTCCTTGG - Intergenic
1161194469 19:2978346-2978368 CCCTTTTCCACCTGTGACCTGGG + Intronic
1164506088 19:28862725-28862747 ACCTCCATAACATGTGACCTAGG + Intergenic
1164731103 19:30504815-30504837 ACCTAAAGAAGCTGTGACCTGGG + Intronic
1165661267 19:37582395-37582417 ACCTGAGTAACCTGTGACCTAGG - Intronic
1165860376 19:38906099-38906121 AGCTGAAAAGCCTGTGACCTGGG - Intronic
1166471274 19:43081482-43081504 TCCTTCACCACTTGTGACCTTGG + Intronic
1167332893 19:48867449-48867471 TCCTTAACAACCAGAGTCCTTGG + Intronic
1167557360 19:50204583-50204605 ACCTCAACAACCAATGACATAGG - Intronic
926717725 2:15938552-15938574 CCCTCACTAACCTGTGACCTGGG - Intergenic
927415259 2:22872679-22872701 ACTTTAACAAGCTGTGACTTGGG - Intergenic
930692411 2:54378153-54378175 ACTTTATCATCCTGTTACCTGGG + Intronic
943685728 2:190816031-190816053 TCCTTGAGTACCTGTGACCTTGG - Intergenic
944535503 2:200705651-200705673 ACCCTGACAACCTTTGATCTGGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
949027332 2:241772729-241772751 ACGTTAACGACCAGTGACCAGGG + Intergenic
1169870879 20:10246893-10246915 AGGTTAACAGCCTGAGACCTAGG + Intronic
1170221094 20:13942395-13942417 ACTTTAAGAACCAATGACCTAGG - Intronic
1170881256 20:20298332-20298354 TCCTCAACAACCTGTGTGCTCGG + Exonic
1173804404 20:45914443-45914465 ACCTTAACAACCTGTCAGACTGG + Intergenic
1174389041 20:50206109-50206131 CTCTTAACAACTTGTGACTTTGG + Intergenic
1175987781 20:62772479-62772501 ACCTTGGTAGCCTGTGACCTTGG - Intergenic
1182837547 22:33356368-33356390 ACCTTCACATCATGTGTCCTTGG - Intronic
1183099442 22:35574902-35574924 GCTTTAACAACCTGTGAGCAGGG - Intergenic
949103741 3:178634-178656 ACCTTGACAACATTTGATCTTGG + Intergenic
951345773 3:21545872-21545894 TCCTCAAAAACCTGTGAGCTGGG - Intronic
955746620 3:62147068-62147090 GTCTTAACAACCTATGACCTTGG + Intronic
956487074 3:69734178-69734200 ACCCTAACATCCTGTTTCCTTGG + Intergenic
966033264 3:175377601-175377623 AGCATAAAAACCTGTGACCATGG + Intronic
968244785 3:197133643-197133665 ACATTAAGAAACAGTGACCTTGG + Intronic
971167149 4:24195816-24195838 ACCTTAACTACATGTGAACCTGG - Intergenic
974756832 4:66220472-66220494 ACCCTATCAACCTGTCATCTAGG + Intergenic
979408328 4:120342264-120342286 ACTTTTACAACTTTTGACCTTGG + Intergenic
979745044 4:124202398-124202420 CCCTTAACAAGCTGTTACGTGGG - Intergenic
985890373 5:2710634-2710656 GCCTAAACAACCAGTCACCTGGG + Intergenic
988702544 5:33689743-33689765 ACCCAAACCACCTGTGACCTTGG + Intronic
991768230 5:70013046-70013068 ACGTGAACAACATGTGAGCTGGG + Intergenic
991847468 5:70888128-70888150 ACGTGAACAACATGTGAGCTGGG + Intergenic
994785214 5:104151260-104151282 ACCTTATGAAAATGTGACCTCGG + Intergenic
998460382 5:142305529-142305551 ACCTTCACTAGCTGTGATCTTGG - Intergenic
1001730586 5:173952776-173952798 CACTTAATGACCTGTGACCTTGG + Intronic
1002532461 5:179856364-179856386 ACTTCAACAACCTTTGACTTAGG - Intronic
1003087594 6:3073408-3073430 GACTCACCAACCTGTGACCTTGG - Intronic
1004111244 6:12720952-12720974 CTCTTAACAACCTGTGAATTAGG - Intronic
1006089873 6:31621931-31621953 ACCTTAGCACCCTGTAACCATGG - Intronic
1006272819 6:32977311-32977333 ACCTTAAGGATCTGTGCCCTGGG - Intronic
1007491414 6:42225356-42225378 ACCTTAACAAAAACTGACCTAGG + Exonic
1010435219 6:75821487-75821509 ACATTAACAACATGTGTACTGGG + Intronic
1011849667 6:91610740-91610762 ATATTAACAACCTATTACCTTGG + Intergenic
1012853024 6:104469508-104469530 TCCTAAACTACCTGTGACTTGGG + Intergenic
1013752698 6:113425512-113425534 ACCTTATCAACCTGTCATTTAGG - Intergenic
1014597245 6:123360107-123360129 ACCTTATCAACCTATCACCTAGG + Intronic
1014848830 6:126314348-126314370 ACCTTAAGAACATGTGTCCAAGG - Intergenic
1016532187 6:145071225-145071247 GCCTTAACACCATGTGAACTGGG + Intergenic
1018398493 6:163399813-163399835 CCCTTATCAACCTGTGAGGTGGG + Intergenic
1022018337 7:26374853-26374875 ACGTCAACAACCTGTTACTTCGG + Intergenic
1022666627 7:32416888-32416910 ACAGTAAAAAGCTGTGACCTTGG + Intergenic
1026466822 7:70661521-70661543 ACCTGATCAGTCTGTGACCTTGG + Intronic
1026873288 7:73866166-73866188 CCCTTGACAGACTGTGACCTTGG - Intergenic
1027632822 7:80628875-80628897 ATCTTATCTACCTATGACCTGGG - Intronic
1028110975 7:86940958-86940980 ACCTTAACACCCAGTCAGCTGGG - Intronic
1031038788 7:116817158-116817180 ACTTTAATAACCTGTGAGATAGG - Intronic
1032989636 7:137378757-137378779 ACTGAAACAACCTGTAACCTGGG - Intergenic
1033207717 7:139437031-139437053 AACTTAACACCCTGTGAAGTGGG + Intergenic
1035482588 7:159199226-159199248 ACCTTAACCTCCTGTGTACTGGG + Intergenic
1035830090 8:2686438-2686460 AACTTAACAAAATGTGACCTGGG - Intergenic
1036055410 8:5247176-5247198 AACTTAACACCATGTAACCTTGG + Intergenic
1036753837 8:11459644-11459666 CCATTAACAACCTGTGACGCTGG + Intronic
1038994664 8:32908053-32908075 ACCTTAACTAACTTTGACCATGG + Intergenic
1042864606 8:73346252-73346274 ACCTTATCTAACTATGACCTTGG - Intergenic
1044629536 8:94265197-94265219 ACCTAACCACCCTGTGACCCTGG - Intergenic
1049490196 8:142894363-142894385 ACCCTCAGAACCTGTGAACTAGG + Intronic
1051787448 9:20760870-20760892 TCATTAACAACCTGTCACCCAGG - Intronic
1055884801 9:81048856-81048878 ATTTTAACAACCTTTGACATTGG + Intergenic
1056733988 9:89189346-89189368 GCCTTAACTGGCTGTGACCTTGG - Intergenic
1056841015 9:89997872-89997894 GCCTTCCCAACCTGAGACCTTGG - Intergenic
1057878473 9:98775234-98775256 ACATTCACAACCTTTGACCCAGG + Intronic
1058970427 9:110077403-110077425 ACTTTAACATCTTGTGACGTGGG + Intronic
1062221161 9:135416109-135416131 ACTTTAATGACCTGTGAGCTTGG + Intergenic
1189269728 X:39742675-39742697 ACATTCACAACCTGTCATCTAGG + Intergenic
1189292927 X:39898637-39898659 ACCTTCAAAATCTGTTACCTGGG + Intergenic
1191010774 X:55755733-55755755 ACCCTAAAAACCAGTGACCAAGG + Intronic
1191937462 X:66440700-66440722 ATTCTAGCAACCTGTGACCTTGG + Intergenic
1192534860 X:71918572-71918594 ACGTTAACATCCTCTGTCCTTGG + Intergenic
1192952605 X:76033313-76033335 ACCTTATCAACCTCTTATCTAGG + Intergenic
1194288605 X:92040187-92040209 ACCAGAGCAACATGTGACCTAGG - Intronic
1199787355 X:151117224-151117246 AGCTAAACAACCTGGAACCTGGG - Intergenic
1200167229 X:154045206-154045228 ACCTGAACCACCAGTGCCCTAGG + Intronic
1200606126 Y:5264752-5264774 ACCAGAGCAACATGTGACCTAGG - Intronic