ID: 914575317

View in Genome Browser
Species Human (GRCh38)
Location 1:148961565-148961587
Sequence ATGTGGACAAGTTCCTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914575311_914575317 8 Left 914575311 1:148961534-148961556 CCATATTAGAAACCACTTGCCTA No data
Right 914575317 1:148961565-148961587 ATGTGGACAAGTTCCTAGTATGG 0: 2
1: 0
2: 0
3: 10
4: 94
914575310_914575317 23 Left 914575310 1:148961519-148961541 CCTTGTATAAGGGATCCATATTA No data
Right 914575317 1:148961565-148961587 ATGTGGACAAGTTCCTAGTATGG 0: 2
1: 0
2: 0
3: 10
4: 94
914575313_914575317 -4 Left 914575313 1:148961546-148961568 CCACTTGCCTACTTGGTCCATGT No data
Right 914575317 1:148961565-148961587 ATGTGGACAAGTTCCTAGTATGG 0: 2
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914575317 Original CRISPR ATGTGGACAAGTTCCTAGTA TGG Intronic
900759655 1:4462251-4462273 ATGTTCACAAGGTCCTAGGAAGG - Intergenic
912677307 1:111695627-111695649 ATGTGGACATTTTCCTGGTGGGG + Intronic
912725410 1:112055000-112055022 ATGTGGAGAAGGTCCTTGTTTGG + Intergenic
913614952 1:120549342-120549364 ATGTGGACAAGTTCCTAGTATGG - Intergenic
914575317 1:148961565-148961587 ATGTGGACAAGTTCCTAGTATGG + Intronic
918019151 1:180667822-180667844 AAATGGACAAATTCCTAGGAAGG - Intronic
919751987 1:201043487-201043509 AGGTGGACAACTTCCTGGAAAGG - Exonic
920937065 1:210445384-210445406 ATGAGGAAAAGTTCATAATACGG - Intronic
921258781 1:213366738-213366760 AGGTGGACAATTTCCCAGAAGGG - Intergenic
1062946145 10:1463697-1463719 AAGAGCACAAGTTCTTAGTAAGG - Intronic
1064558290 10:16569421-16569443 AGGTGGAGAATTTTCTAGTAGGG + Intergenic
1075358346 10:121804516-121804538 ATTTTGACAAGTTACTATTACGG + Intronic
1075594335 10:123717126-123717148 ATGTGGACTAGTGCCTAGCAAGG + Intronic
1081498446 11:43639970-43639992 AAGTCCACAAGTACCTAGTAGGG + Intronic
1082919288 11:58474872-58474894 AAATGGACAAATTCCTAGAATGG + Intergenic
1091156759 11:133381806-133381828 ATGTGGACACATTCATAGCAGGG + Intronic
1100145568 12:91673450-91673472 ATGGGGCCCAGTTCATAGTATGG - Intergenic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1109495671 13:63168682-63168704 AAGTGGAAAAGTTGCAAGTATGG - Intergenic
1112175330 13:97017613-97017635 ATATGGACAAGTGCTTAGCATGG - Intergenic
1116662794 14:47733509-47733531 ATGTTGTCAAGTTCCCAGTGTGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118989686 14:70786562-70786584 AGGGGGACAATTTCCTTGTAAGG - Intronic
1129637369 15:77335045-77335067 ATGTGGACAGGTTTCTTCTAGGG + Intronic
1129666398 15:77581922-77581944 ATGTGAACAAGGTCCTTTTAAGG - Intergenic
1131122546 15:89831571-89831593 TTGTGGACCAGTCTCTAGTAAGG - Exonic
1139130144 16:64133265-64133287 ATATGAACAAGTTCCAAATAAGG + Intergenic
1143035767 17:3996250-3996272 ATGTGGACAAATTTCTAGAAAGG - Intergenic
1144255387 17:13462540-13462562 AGGTGAACAATTTCCCAGTAGGG - Intergenic
1147598235 17:41730437-41730459 GTGTGCAGAAGTTCCTGGTAGGG + Intronic
1150626484 17:66844689-66844711 ATGATGACAAGTTCCTACTTTGG + Intronic
1151274335 17:73022636-73022658 ATGAAGGCAATTTCCTAGTATGG - Intronic
1153520087 18:5943536-5943558 ATGTGGCCACGCTCCTGGTAGGG + Intergenic
1156810490 18:41243784-41243806 AGGTGGAGAAGTACCTAGTTAGG + Intergenic
1163908936 19:20171564-20171586 ATGTGGCCCAGATCCTAGGATGG - Intronic
1165552964 19:36604622-36604644 ACGTGGACAAGGTCCCCGTATGG - Intronic
927302515 2:21531947-21531969 ATATGGACAAATTCCTAGAAAGG - Intergenic
928119149 2:28569618-28569640 AAATGGACAAATTCCTAGAAAGG + Intronic
932969233 2:76518428-76518450 ATCTGGAAAAGTTCCTGGTTTGG + Intergenic
933655064 2:84880588-84880610 ATGTGCCCAAGTTCCTGGTCCGG + Intronic
938062206 2:128262712-128262734 ATGAGGACACCTTCCTAGGAGGG - Intronic
942815102 2:180043708-180043730 AAATGGACAAATTCCTAGAAAGG - Intergenic
945075988 2:206039900-206039922 AAATGGACAAGTTCCTAGAGAGG + Intronic
946859191 2:223984122-223984144 ATGTTGAAAAGTTCATAGAAAGG + Intronic
1169317339 20:4603500-4603522 TCGTGGACAAGTTACTAGTCAGG + Intergenic
1170496490 20:16930338-16930360 ATGTTGAAAAGCTCTTAGTAGGG + Intergenic
1175316574 20:58052777-58052799 ATGTGGACAAATTTCTGGTTAGG - Intergenic
1176004731 20:62854599-62854621 CTGTGCACGAGTTCCTGGTAGGG - Intronic
1178585893 21:33870551-33870573 ATGTGGAGAAATTCTTAGCATGG + Intronic
1178994119 21:37381912-37381934 ATGAGGAAAAGTTTGTAGTATGG + Intronic
1180697075 22:17758343-17758365 AACTGGATAAGTTCCTAGTGCGG - Intronic
952891994 3:38049516-38049538 ATGTGGACAAGTTTCCAGCAAGG - Intronic
957459412 3:80497504-80497526 AGGTAGACAAGTTCCTAGGCAGG - Intergenic
961671025 3:128531015-128531037 AAGTGGGCAAATTCCTAGAAAGG - Intergenic
962727542 3:138246803-138246825 ATGTGTATAATTTCCTGGTAAGG + Intronic
966932930 3:184687468-184687490 ATGTGGCCTACTTCCTAGAACGG + Intergenic
970801521 4:19978178-19978200 ATGTGGCCAAGTTCTTTGGAAGG - Intergenic
971796141 4:31230746-31230768 ATGAGGACAATTTCAGAGTATGG + Intergenic
973814694 4:54608509-54608531 ATGTGGACAAATTTCTCTTAAGG + Intergenic
977942582 4:102874961-102874983 AGGTGAACAATTTCCTAGTTAGG + Intronic
978332407 4:107628709-107628731 ATATGTACAAGTACCTACTAAGG + Intronic
981196869 4:141931169-141931191 ATCTGGACAAGTTCCTTTTTAGG + Intergenic
983540678 4:168906362-168906384 ATGTGGAAAAGTTCTCAGTGAGG + Intronic
984745245 4:183209171-183209193 ATGTGAACAAGTTCAGAGTGTGG + Intronic
988411048 5:30886265-30886287 ATGTGGACAAGTTCATAAAGGGG - Intergenic
991893546 5:71365781-71365803 ATGTGCCCTAGTTCCTAGCAAGG - Intergenic
993489076 5:88524067-88524089 ATTTAGACAAGTTCCAAATAAGG + Intergenic
995130724 5:108627726-108627748 GAGTGGACAAGTACCTAGGATGG - Intergenic
997221646 5:132171844-132171866 AAGTGGAAAAGTTCCTAGAAAGG + Intergenic
997513165 5:134466673-134466695 ATGTGGCCAATTCCCTAGTGGGG + Intergenic
999444008 5:151624332-151624354 ATGAGGGCAGGTTCCAAGTATGG + Intergenic
1001135111 5:169096161-169096183 ATGTGGAAAAATTTCCAGTAGGG - Intronic
1001164271 5:169349259-169349281 GTGTGGCCAAGTTCCTAACAGGG - Intergenic
1005162766 6:22883633-22883655 ATGTGGATAATTTCCTAAAAGGG - Intergenic
1010267368 6:73882139-73882161 ATGTTTACAAGTGCCTGGTAAGG - Intergenic
1010387163 6:75294408-75294430 ATATGGACATGTTTTTAGTAAGG - Intronic
1011945999 6:92903997-92904019 ATGTGAACAAGTCCCAAGTCTGG - Intergenic
1012007954 6:93739758-93739780 ATGAGGAAATGGTCCTAGTAGGG + Intergenic
1021755889 7:23851694-23851716 AAATGGACAAATTCCTAGAAAGG + Intergenic
1022765859 7:33410580-33410602 ATGTAGACAAGTTTCTAGAAGGG - Intronic
1022928658 7:35085072-35085094 AAATGGACAAGTTCCTTGAAAGG - Intergenic
1023421905 7:39989445-39989467 ATGTGGACAAGTGCTTACTTTGG + Intronic
1023655371 7:42414278-42414300 ATGTGTTCATGTTCCTTGTAGGG + Intergenic
1023997455 7:45169937-45169959 AAATGGACAAATTCCTAATAAGG - Intronic
1028404711 7:90463042-90463064 AGGTGGCCAGGTTCCTAGAAGGG - Intronic
1028901407 7:96104111-96104133 ATGTGGCCAAGATACTAGAAGGG - Intronic
1029836114 7:103312630-103312652 ATCTCGACAAGTTCCTAGGAAGG + Exonic
1031827093 7:126578933-126578955 ATGTGAAAAATTTCCTTGTAGGG - Intronic
1038020870 8:23551008-23551030 GTGTGGCCAAGTTCATACTATGG - Intronic
1042508487 8:69586808-69586830 ATGTGGACAAGTCCTTGGTTGGG - Intronic
1043289052 8:78573037-78573059 TTGTGAACAGGTTCCTTGTAGGG - Intronic
1044322871 8:90824410-90824432 ATGTGGACATCTTTCTTGTATGG + Intronic
1046060545 8:109134413-109134435 ATTTGTAAATGTTCCTAGTAGGG - Intergenic
1048358590 8:133674788-133674810 ATTTTGACAAGATCCTAGTTTGG - Intergenic
1051284058 9:15476823-15476845 ATGAGGATAAGTTCCTAAAAAGG + Intronic
1051640835 9:19223240-19223262 ATGTGGACAAGTGCCACTTAGGG + Intergenic
1054943940 9:70774426-70774448 ATGTTGATATGTTACTAGTAAGG + Intronic
1056483585 9:87031656-87031678 ATGTGCAGAAGTTCCTAGGCTGG - Intergenic
1056972670 9:91220523-91220545 ATGTGCACAACTTCCTAGCAAGG - Intronic
1059289051 9:113205674-113205696 ATATGGTCAAGTTCCTATTTTGG - Intronic
1060486900 9:124053499-124053521 AGGTGGAAAAGTACCCAGTATGG - Intergenic
1062502182 9:136856338-136856360 AGGTGGACAAGGTCCTTCTAGGG + Intronic
1186174968 X:6916787-6916809 ATGTAGACAAGCTTCTAGGAAGG - Intergenic
1194198141 X:90921631-90921653 ATATGAACAAGTTCCTTATATGG + Intergenic
1197338019 X:125232038-125232060 ATGTCCACAAGTTTCTAGTATGG - Intergenic
1200543600 Y:4491200-4491222 ATATGAACAAGTTCCTTATATGG - Intergenic