ID: 914575823

View in Genome Browser
Species Human (GRCh38)
Location 1:148967239-148967261
Sequence ACTTATGTATGAACAAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914575823 Original CRISPR ACTTATGTATGAACAAGAAT TGG (reversed) Intronic
900809397 1:4789983-4790005 ACTGAAGAGTGAACAAGAATGGG - Exonic
904926569 1:34053807-34053829 ACTTATAAATGCACAAGAAAGGG + Intronic
909310665 1:74143628-74143650 ACTTATGTATAATGAAGATTAGG - Intronic
909911933 1:81270654-81270676 ACTCATGTATGTATAAGTATGGG + Intergenic
909958761 1:81809686-81809708 ACATATGTGTGACCAAGAAAGGG - Intronic
911449672 1:98046823-98046845 ACTTATAGATGTACAAAAATAGG + Intergenic
912030430 1:105235311-105235333 TCTTATATATGAAGAAGAAATGG + Intergenic
912206751 1:107517461-107517483 GCTTATGTATCAACCAGCATAGG + Intergenic
913614447 1:120543662-120543684 ACTTATGTATGAACAAGAATTGG + Intergenic
914347337 1:146811182-146811204 ACCTGGGGATGAACAAGAATGGG - Intergenic
914575823 1:148967239-148967261 ACTTATGTATGAACAAGAATTGG - Intronic
916238219 1:162612041-162612063 CCATATATATGATCAAGAATTGG + Intergenic
918179227 1:182071558-182071580 ACTTATGTGTAAATAAGTATAGG + Intergenic
918397240 1:184126468-184126490 ACTTATGTGTGAATAAGTATAGG + Intergenic
918405057 1:184204002-184204024 TTTTATGTATCAACATGAATAGG - Intergenic
919947512 1:202330611-202330633 ACTTAAGTATGCATAAGCATAGG + Intergenic
920947653 1:210544707-210544729 ACCCATGTATGAACTAGATTAGG - Intronic
921040137 1:211423299-211423321 ACTTTTGTGTGAATAAGTATAGG + Intergenic
922659228 1:227414853-227414875 ACATACATAAGAACAAGAATAGG - Intergenic
924760306 1:246978587-246978609 AAAAATGTATGAACAAAAATAGG - Intronic
1063238696 10:4146001-4146023 ACTGATGGATGAACAAGTATGGG - Intergenic
1063505460 10:6594033-6594055 ACTTACTTATGCAGAAGAATTGG + Intergenic
1063955288 10:11259758-11259780 ACATATATATGATGAAGAATTGG - Intronic
1064394531 10:14970653-14970675 ACTTATGAATTAGCGAGAATAGG - Intronic
1064494642 10:15896476-15896498 ACTTGAATATGAAGAAGAATGGG + Intergenic
1064831516 10:19473068-19473090 TCTTATATATGAACAAGCTTTGG - Intronic
1065415399 10:25479838-25479860 ACTTATGTATCACGAAGAAGAGG - Intronic
1068173438 10:53425017-53425039 AAGTATCTATGATCAAGAATAGG + Intergenic
1071842994 10:89492374-89492396 AGTTTTTTAGGAACAAGAATGGG + Intronic
1072633342 10:97162271-97162293 TCTTATGTATCCACTAGAATGGG + Intronic
1072814734 10:98494771-98494793 AATTATGTAGAAACAAAAATTGG + Intronic
1072920767 10:99575299-99575321 TTTTATATCTGAACAAGAATGGG + Intergenic
1073206385 10:101771478-101771500 ACATCTGCATGAACAAGAAGGGG - Exonic
1074170732 10:110933411-110933433 ACTTATGTTTGTACAAGATAAGG + Intronic
1074265553 10:111899548-111899570 GCTTCTGTGTGAACAGGAATAGG - Intergenic
1077852696 11:6089502-6089524 ACTTATTTATTAACTAAAATAGG - Intergenic
1080347220 11:31338428-31338450 AGGCATGTATGATCAAGAATAGG + Intronic
1081003068 11:37698363-37698385 ACATAATTATGAACAAAAATAGG - Intergenic
1085864296 11:80270536-80270558 AATTATGCTTGCACAAGAATTGG - Intergenic
1092336260 12:7636671-7636693 TATTATGTATTAACAAGAACTGG - Intergenic
1093729177 12:22548343-22548365 ACAGATGTATAAACCAGAATAGG - Intergenic
1094016349 12:25868737-25868759 ATGTATGTATGTAAAAGAATAGG + Intergenic
1094816422 12:34190615-34190637 AGTTATCTCTGAACAGGAATAGG + Intergenic
1095175037 12:39081825-39081847 ACTTATTTGTTAAGAAGAATGGG + Intergenic
1095222381 12:39631639-39631661 ACTTATATACAAACAAAAATTGG + Intronic
1095684123 12:45012900-45012922 GCTTATGTATGCAATAGAATAGG + Intergenic
1098260055 12:68660094-68660116 ACTTATGCATGAGCAAGCAAGGG - Exonic
1099599997 12:84722567-84722589 ACTTAGGTTTGATGAAGAATTGG - Intergenic
1099632311 12:85166092-85166114 ATTTATGTATAAATAAAAATAGG - Intronic
1099988034 12:89691425-89691447 ACTTATTTATTCACCAGAATTGG + Intronic
1100103045 12:91133278-91133300 ACTCAGGTATGAAAAAGAATTGG - Intergenic
1100603980 12:96135915-96135937 ACTTTGTTATGAAAAAGAATAGG + Intergenic
1101019416 12:100538033-100538055 ACTGAGGCATGAACAAGAATAGG + Intronic
1101996105 12:109526127-109526149 ACAAATGTTTGAACAAGGATTGG + Intronic
1102070934 12:110018809-110018831 AATTATGTATGCACAACATTGGG - Intronic
1103252569 12:119512991-119513013 CCAGATTTATGAACAAGAATTGG - Intronic
1105464484 13:20625142-20625164 AGTTTGGTATCAACAAGAATTGG + Intronic
1108752886 13:53466121-53466143 ACTAATTTATGAACAAGGTTTGG + Intergenic
1109284265 13:60393838-60393860 ATTTATGGATGAAGAAGAATTGG - Intergenic
1109611202 13:64766760-64766782 ACTTATTTATGGAAAAGAGTAGG - Intergenic
1110716822 13:78715344-78715366 AGATATGTATGAATAAAAATGGG + Intergenic
1110884821 13:80619505-80619527 AGTTCTGTCTGAACAAGAAATGG - Intergenic
1111459816 13:88524626-88524648 AGTTATGTATGAGCAAGTCTAGG - Intergenic
1112809950 13:103206738-103206760 ACTGATGTATGAAAAAGGAACGG - Intergenic
1115355836 14:32445784-32445806 ACAAATGTATCAACAAAAATAGG - Intronic
1115674566 14:35656834-35656856 ATTTATGGGTGAACAACAATAGG - Intronic
1117519408 14:56535469-56535491 ACTTAGGTAAGGACAAAAATTGG - Intronic
1118337726 14:64868211-64868233 TCTTATGTTTGAATAATAATTGG - Intronic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1124795431 15:32773579-32773601 ACCGATGTAAAAACAAGAATGGG + Exonic
1125082951 15:35697068-35697090 AATTTTGTATCAACAAGAATTGG + Intergenic
1125364029 15:38894613-38894635 AATTATGAATGAATGAGAATTGG - Intergenic
1127235803 15:57050119-57050141 ACATTTGTATGACAAAGAATAGG - Intronic
1127953188 15:63830163-63830185 AGATATGTATGAACAATAAAGGG + Intronic
1128100172 15:64992136-64992158 ACTTATGTATACACATGCATAGG - Intergenic
1128538252 15:68506611-68506633 TCTTATTTAGGAACAAGAAAAGG - Intergenic
1129053655 15:72803994-72804016 ATTTTTATATGAACAAAAATTGG + Intergenic
1131193763 15:90338316-90338338 ACTTATGTACCACCAAGAAAGGG - Intergenic
1131358156 15:91764355-91764377 AATAATGTATGACCAAGTATCGG + Intergenic
1131371388 15:91885043-91885065 ACTTCTAAAGGAACAAGAATTGG - Intronic
1132078672 15:98845764-98845786 ACTTATGGGCAAACAAGAATTGG - Intronic
1132090482 15:98944383-98944405 AGATATGTATAAACATGAATAGG + Intronic
1134884587 16:17778345-17778367 AAATATGTATGGGCAAGAATTGG + Intergenic
1135172014 16:20193056-20193078 ATTTGTGAATGAACAAGAAAAGG + Intergenic
1137294910 16:47082748-47082770 ACTTATGTAAGAAAATGAAATGG + Exonic
1138323285 16:56137996-56138018 ACTTATAAATCAACAATAATAGG - Intergenic
1139986650 16:70904063-70904085 ACCTGGGGATGAACAAGAATGGG + Exonic
1140262854 16:73395691-73395713 ACTTATGAAAGAAAAACAATTGG - Intergenic
1144237422 17:13275245-13275267 TCATATGTATGGACAGGAATGGG - Intergenic
1146672372 17:34750305-34750327 AGTTATTTATGAACACTAATAGG - Intergenic
1147807651 17:43143563-43143585 AAATCTGAATGAACAAGAATTGG - Intergenic
1148169482 17:45507282-45507304 AAATAGGAATGAACAAGAATTGG - Intergenic
1148365870 17:47055381-47055403 AAATAGGAATGAACAAGAATTGG + Intergenic
1150400671 17:64853769-64853791 AAATAGGAATGAACAAGAATTGG - Intergenic
1150494682 17:65598068-65598090 TCTTCTGTGTGAACAAAAATAGG + Intronic
1152659620 17:81536217-81536239 ACGTGTGCATGAAGAAGAATGGG + Exonic
1154933223 18:21022727-21022749 ACCCATGTATGAACAAGAGTGGG - Intronic
1157033905 18:43947850-43947872 ATTTATCTCTAAACAAGAATTGG + Intergenic
1157626655 18:49056503-49056525 AATCATGAATGAAAAAGAATAGG - Intronic
1162599755 19:11658945-11658967 TGTGACGTATGAACAAGAATGGG - Intergenic
1164132361 19:22376430-22376452 ACTTCTATATGAAAAATAATGGG + Intergenic
925353684 2:3222017-3222039 ACTTATGTATGCATTTGAATGGG + Intronic
928251524 2:29685459-29685481 ACTTCTCTATGGACAAGAAATGG - Intronic
930259703 2:49130865-49130887 ACTTAGGTAAAAACAAGAAGGGG + Intronic
930308736 2:49710975-49710997 ACTTATGTATAAACAAGCAAGGG - Intergenic
934501924 2:94868858-94868880 ATTTAATTATGAACAAGAAAAGG + Intergenic
934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG + Intergenic
936709998 2:115121230-115121252 ACTTATGTAAGAATAGTAATTGG + Intronic
936768408 2:115881924-115881946 ACTTATGTATGAAGAAGTGAGGG + Intergenic
940267544 2:151855237-151855259 ACTTTTACATGAACAATAATTGG + Exonic
940295123 2:152114647-152114669 TCTTATGTATCTAAAAGAATTGG + Intergenic
941089091 2:161153790-161153812 AATAATGTATGAACAAGATCTGG - Intronic
942603431 2:177664944-177664966 TCAGATGTATGAACAAGAGTGGG + Intronic
943110035 2:183593174-183593196 AATAATGTATCAACAAGCATGGG - Intergenic
943822456 2:192343652-192343674 ACTTATATATAAACAAAAATAGG + Intergenic
946741932 2:222811281-222811303 GCTTGTGTATGAACAATAACAGG - Intergenic
1173792667 20:45838073-45838095 ACTTATTTAAGAAAAAAAATAGG - Intronic
1175169110 20:57067540-57067562 ATATATGTATGAAGAGGAATTGG + Intergenic
1178241359 21:30904846-30904868 ACATATGTATTAACACTAATAGG + Intergenic
1181114860 22:20625471-20625493 AGTTAGGTATGAGCAAGTATTGG - Intergenic
1182512001 22:30826479-30826501 ACTTCAGGATGAACTAGAATGGG - Intronic
1184295954 22:43525741-43525763 AGATATGTAAGAACAAGCATGGG + Intergenic
1184811420 22:46835357-46835379 AATAATATATGAACAAAAATGGG + Intronic
951339859 3:21471900-21471922 ACTTATGTATGTAATAAAATGGG - Intronic
951392605 3:22125117-22125139 ACATATGTATGCAAAAGAATGGG - Intronic
953807500 3:46083773-46083795 ACTTATGTATATACAACAAGAGG - Intergenic
955605571 3:60698939-60698961 GCTTATGTATTAAGATGAATGGG - Intronic
956047951 3:65216466-65216488 ACTGATGTTTGACCAAAAATTGG - Intergenic
957042168 3:75344095-75344117 ACTTAAGAAAGAGCAAGAATGGG + Intergenic
957086835 3:75687666-75687688 AGTTATCTCTGAACAGGAATAGG - Intergenic
957829086 3:85492250-85492272 ACTTATGGATCAAAAAGAAAGGG - Intronic
959044257 3:101454214-101454236 ACATATGTATGTCTAAGAATGGG + Intronic
959390055 3:105762177-105762199 ACTTATGTTTCAAGAAGAAGCGG + Intronic
959455560 3:106556591-106556613 ACTTATGCATGAGCAAGATGTGG - Intergenic
960065086 3:113362798-113362820 ACTGAAGTATAAACAAAAATTGG - Intronic
960263152 3:115590938-115590960 AGTCATGTATGAACAAGACAGGG + Intergenic
961990136 3:131180993-131181015 ACTATTGTAGGAAGAAGAATGGG + Intronic
964429077 3:156585109-156585131 ATTTATTTATGTTCAAGAATAGG - Intergenic
965179739 3:165387141-165387163 GCTTATGGATGAAAATGAATAGG - Intergenic
965433308 3:168615784-168615806 ACTTTGGTGTTAACAAGAATGGG + Intergenic
965490497 3:169329613-169329635 ACTTTACTATGAACAAGAACTGG - Intronic
967659546 3:192089721-192089743 ACTTATGTATAAAGATAAATAGG + Intergenic
969030969 4:4213787-4213809 TCTTATATATTAACAACAATGGG + Intronic
969446949 4:7250621-7250643 ATTTGTGTATGAACAAGAAAAGG + Intronic
971549430 4:27931250-27931272 ACTTCTGTGTGATGAAGAATTGG + Intergenic
972164149 4:36261712-36261734 AATTATTTGTTAACAAGAATAGG + Intergenic
973108399 4:46369365-46369387 ATTTATTTAAAAACAAGAATAGG + Intronic
973169607 4:47123234-47123256 ACATATGTATGTATAAGAACTGG - Intronic
974158686 4:58108619-58108641 AATTTTGTCTGAACAAGAGTTGG - Intergenic
974170106 4:58255465-58255487 ACTTATGTCTGCACATGAACTGG + Intergenic
976479053 4:85518215-85518237 AATTAAATATGAAAAAGAATTGG + Intronic
977816648 4:101421483-101421505 GCTTATGTATGTATGAGAATTGG - Intronic
979079431 4:116315575-116315597 ACATACATTTGAACAAGAATGGG + Intergenic
979133855 4:117084380-117084402 CCTCATGTATGAAAAAGAAACGG - Exonic
981946025 4:150345125-150345147 AAGTATGTATGCACAAGCATAGG - Intronic
982453617 4:155581267-155581289 TCTTATGAATGAGCAAGAAAAGG + Intergenic
983589687 4:169394586-169394608 CCTTTAGCATGAACAAGAATGGG - Intronic
989704347 5:44310442-44310464 ACTTAGCCATGAACAAGAAGGGG - Exonic
992373619 5:76170440-76170462 ACTTATGCATGAGCAAGCAAGGG + Intronic
994555504 5:101295870-101295892 ACTAATGTATTAACAGCAATGGG + Intergenic
994738521 5:103589350-103589372 ACTTATGAGTGAAAAAAAATAGG - Intergenic
995311704 5:110720316-110720338 TCTTATGCATGAAGAAGACTGGG + Intronic
995817016 5:116181973-116181995 ACATATATATGAACAAAAACAGG + Intronic
996115006 5:119608537-119608559 ACATGTGTTTGAAAAAGAATAGG - Intronic
996136260 5:119846102-119846124 ACTTATTTATGAACGAGTTTGGG - Intergenic
996408047 5:123126181-123126203 ACTTATGCATGTACAAAAGTGGG - Intronic
998628562 5:143873496-143873518 ACTGGTGTTTGAACAAAAATGGG + Intergenic
998925045 5:147113828-147113850 ACATTTGGATGAACAAGGATGGG - Intergenic
999055268 5:148568265-148568287 GCTTATGTAAGAACAAAAAATGG - Intronic
999206950 5:149855814-149855836 AATTATATATAAACAAGAACAGG + Intergenic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
1000278388 5:159760676-159760698 AGTTATGGATGAACAAGTTTTGG - Intergenic
1002560955 5:180081903-180081925 CCATATGTATGAACAAGGACTGG + Intergenic
1004773405 6:18812919-18812941 AGTTATGTATGAAGAAGAAAAGG + Intergenic
1005460294 6:26062796-26062818 ACATATGTATGAAGAAAAAATGG + Intergenic
1010073932 6:71779049-71779071 TCTAATGTTTGAAAAAGAATTGG - Intergenic
1012556193 6:100515358-100515380 ACTTATTTTTGAGCAAGACTTGG - Intronic
1013857590 6:114592633-114592655 ACTTCTGTGTGAACAAGTCTAGG + Intergenic
1014342666 6:120228694-120228716 ACTTATGTTTAAACAAGAAGCGG - Intergenic
1015318056 6:131839684-131839706 ATTTATGTATAACCAAAAATTGG + Intronic
1015449425 6:133348163-133348185 ATTTATGTTTAAGCAAGAATGGG - Intronic
1015973428 6:138765545-138765567 ACTTCTTTATGAAAAAAAATAGG + Intronic
1018593789 6:165455890-165455912 ACTTGGGTAAGAACAAGACTTGG - Intronic
1021970836 7:25964446-25964468 ACTGAGGTATGAATAAGAAGTGG + Intergenic
1022256162 7:28660737-28660759 ATTAATGTAAGAATAAGAATGGG - Intronic
1022382961 7:29877551-29877573 ACTTATGTGTGAAGAAGTGTAGG + Intronic
1023246438 7:38209817-38209839 ACTTGTCTGTGAACAAGAACAGG - Intronic
1024854198 7:53758032-53758054 ACTTGTGTCTTAACAAAAATGGG + Intergenic
1027453129 7:78355689-78355711 ACTTATGTATGTACAGACATGGG + Intronic
1027681407 7:81226417-81226439 TCTTATGTATGCACATGTATAGG + Intergenic
1029728162 7:102421984-102422006 ACTTATGTGTGAATAAGTGTAGG + Intronic
1031461670 7:122058301-122058323 ACTTAAGTAAGAATCAGAATTGG + Intronic
1036048876 8:5173864-5173886 ACTTATGTTTGAAAAATAAATGG - Intergenic
1037724583 8:21472778-21472800 AGTTATGTATGAACTAGAAGGGG - Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039188017 8:34939080-34939102 ACTTATGTATGAAGTCGACTTGG - Intergenic
1039285614 8:36037398-36037420 CCTGATGTTTAAACAAGAATGGG + Intergenic
1043615422 8:82119158-82119180 ACTTATGTGTGTACATCAATGGG + Intergenic
1046189997 8:110782067-110782089 AATTATTTATGATCTAGAATAGG - Intergenic
1050415302 9:5409940-5409962 TCTTATCTAAGAACAAGCATAGG + Intronic
1050776806 9:9273825-9273847 ACTGAATGATGAACAAGAATGGG - Intronic
1051797950 9:20896318-20896340 ACAAAGGTATTAACAAGAATAGG - Intronic
1052609619 9:30756937-30756959 GCTTTTGTAGGAACAAGAGTTGG + Intergenic
1056537440 9:87542220-87542242 AATTCCGTATGAACAATAATAGG + Intronic
1056581700 9:87891274-87891296 ACTTATGTATGAGGTAGATTAGG - Intergenic
1058627392 9:106949379-106949401 ATTTATGTGTGAACAAGCCTGGG + Intronic
1059069299 9:111118630-111118652 AATCAGCTATGAACAAGAATGGG - Intergenic
1059139256 9:111836380-111836402 ACTTAGGTATTAACTGGAATGGG + Intergenic
1060294318 9:122332815-122332837 CCATATGTTTCAACAAGAATAGG + Intergenic
1203375448 Un_KI270442v1:371922-371944 AGTTATCTCTGAACAGGAATAGG + Intergenic
1186575057 X:10756610-10756632 ACTTATGTATGCATCAGAAGGGG + Intronic
1186628303 X:11319235-11319257 ACATATGTAAGTACAAGTATAGG - Intronic
1187626124 X:21115926-21115948 ATTTATATTTGAACAAGAAAGGG + Intergenic
1191682957 X:63859978-63860000 GCTGATGTATGAAAAAAAATTGG + Intergenic
1193052826 X:77119270-77119292 ACTTGCGTATGAACAAGTTTTGG + Intergenic
1193429578 X:81384794-81384816 CCAAATGTATAAACAAGAATTGG - Intergenic
1193431471 X:81411559-81411581 ACTTTTGTAGTAACAAAAATGGG + Intergenic
1193873104 X:86825945-86825967 ACTTATTGATGAGGAAGAATAGG - Intronic
1195512479 X:105733237-105733259 ACCTATAGATAAACAAGAATAGG - Intronic
1196349988 X:114717513-114717535 ACTCATGTTTTAACAAAAATTGG - Intronic
1196650395 X:118162946-118162968 CCTTGTGTTTGAACAAGGATAGG - Intergenic
1197449877 X:126599109-126599131 AATCATGTAAGAACAAGCATGGG + Intergenic
1198363728 X:135920799-135920821 TGTGATGTATGAACAAGCATGGG - Intergenic
1198921319 X:141731267-141731289 ATTTATATATGAACAAGATTAGG - Intergenic
1198974544 X:142321430-142321452 ACTTTTTGATAAACAAGAATGGG - Intergenic
1199081969 X:143587217-143587239 TCTTATTTAGGAACAAAAATGGG - Intergenic
1199536549 X:148908686-148908708 ACTCAAGTATGAACACAAATTGG + Intronic
1201554845 Y:15257100-15257122 AGTTAGGTATGTACAAGAACTGG - Intergenic
1202275175 Y:23110753-23110775 ACGTATTTATCAACAAAAATTGG - Intergenic
1202290853 Y:23309938-23309960 ACGTATTTATCAACAAAAATTGG + Intergenic
1202428166 Y:24744472-24744494 ACGTATTTATCAACAAAAATTGG - Intergenic
1202442625 Y:24925617-24925639 ACGTATTTATCAACAAAAATTGG + Intergenic