ID: 914580041

View in Genome Browser
Species Human (GRCh38)
Location 1:149011270-149011292
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 2, 1: 1, 2: 2, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914580041_914580043 -5 Left 914580041 1:149011270-149011292 CCTTCAGTGTGGTTTGTTGTGAG 0: 2
1: 1
2: 2
3: 15
4: 145
Right 914580043 1:149011288-149011310 GTGAGGTTTGACTTGAGTAGAGG 0: 3
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914580041 Original CRISPR CTCACAACAAACCACACTGA AGG (reversed) Intronic
900717452 1:4154031-4154053 CTCACACCGAATCACACTGCTGG - Intergenic
903789873 1:25885499-25885521 CTTACAACAAACCACAAGGCAGG + Exonic
903898745 1:26626798-26626820 CTCAGACCAACCCAAACTGAGGG + Intergenic
909748009 1:79123180-79123202 CTCACATCAAATCACTCTAATGG + Intergenic
910274830 1:85437862-85437884 CTCACAACAAATCTAACAGACGG + Intronic
911111288 1:94189475-94189497 TTAAAAACAAACCACACTCATGG + Intronic
911834649 1:102601353-102601375 CTCAAAACAAAACACATTGATGG - Intergenic
912033938 1:105287026-105287048 CTGGCAATAAAACACACTGATGG + Intergenic
913611149 1:120510969-120510991 CTCACAACAAACCACACTGAAGG + Intergenic
913983647 1:143545844-143545866 CTCACAACAAACCATACTGAAGG - Intergenic
914580041 1:149011270-149011292 CTCACAACAAACCACACTGAAGG - Intronic
916188276 1:162154262-162154284 CTCAAAACAAAACACCCTGCTGG + Intronic
916207714 1:162331671-162331693 TTCACCACTAACAACACTGATGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918285274 1:183048303-183048325 GTCAGAACAAATTACACTGAGGG - Intronic
921096692 1:211892790-211892812 CACACGACAAACAACACTGATGG - Intergenic
1064564483 10:16625917-16625939 CTCACAACTAACTACACTGCAGG + Intronic
1067278753 10:44855605-44855627 CTCACAACAAAGCCCAGTGCTGG - Intergenic
1067600738 10:47595520-47595542 CTCACAACTAATGACACTCATGG + Intergenic
1070481834 10:76890398-76890420 CTCATACCAAAGAACACTGATGG + Intronic
1072806461 10:98426626-98426648 ATCATTACAAACCACACTGTGGG + Intronic
1072934914 10:99702936-99702958 CTCACAACAAACCAGTCTTTAGG + Intronic
1076157876 10:128217186-128217208 CTCACGACAAACTACAGGGAAGG - Intergenic
1076352876 10:129830951-129830973 CTCCCAACACTCCACATTGATGG - Intergenic
1076834029 10:133012027-133012049 CTCCCTTCAAACCACACTGTAGG + Intergenic
1077128740 11:958256-958278 CTCACCAGAAACCACCCTGCTGG + Intronic
1077758420 11:5062315-5062337 TACCCAACAAACAACACTGAGGG - Intergenic
1079138118 11:17787952-17787974 CTGACCACAAACCAGAATGATGG - Intergenic
1080281595 11:30563507-30563529 CTCCCAACAAACCATTCTTAAGG + Intronic
1084033535 11:66494535-66494557 CTCACAACAGCCCACACAGCAGG - Intronic
1090632192 11:128659501-128659523 CTCACACCATACCATACAGAAGG + Intergenic
1101346658 12:103892089-103892111 CTGAAAACAAACCATATTGATGG + Intergenic
1101905541 12:108822433-108822455 ATAACAACAAAACACACTTATGG - Intronic
1103536510 12:121637393-121637415 CACAGAACAAACCACACAGCTGG - Intronic
1106746189 13:32710785-32710807 ATCACAACTAACCAGACTAATGG - Intronic
1108316715 13:49243812-49243834 CTCTCAACAAAGCAAGCTGATGG - Intergenic
1108327598 13:49348854-49348876 ATCACAACAAATCTCTCTGACGG + Intronic
1110057998 13:71001956-71001978 CTCACAACTCACAATACTGAAGG + Intergenic
1111679765 13:91428178-91428200 CTCACAACTCACCAAACTGTGGG - Intronic
1112724646 13:102289156-102289178 CTCACAAGAGACCACACTCAAGG - Intronic
1113421680 13:110175980-110176002 CTCACTACAATAGACACTGATGG + Intronic
1113923453 13:113927549-113927571 CACACACCCAACTACACTGATGG + Intergenic
1114351647 14:21859185-21859207 TTCACTACTAGCCACACTGATGG + Intergenic
1116183047 14:41559545-41559567 TTCACCAGAAACCACTCTGATGG + Intergenic
1122322149 14:100861616-100861638 CTCACAGAAAGCCACTCTGAGGG - Intergenic
1123015466 14:105371900-105371922 CTCACCACACAACACACAGAAGG - Intronic
1124376957 15:29134504-29134526 CCCACCACAAGCCACCCTGAAGG + Intronic
1125256223 15:37766548-37766570 CTCAGAACAAACAACTGTGAAGG - Intergenic
1126229634 15:46309861-46309883 CTAACAACTAACCACATTGTTGG + Intergenic
1128156600 15:65395529-65395551 CTCTCAACAAACATGACTGAGGG + Intronic
1128752297 15:70158322-70158344 CTCACACCAAAGGACACGGAGGG - Intergenic
1129497274 15:75996283-75996305 CTCTTAACAATCTACACTGAGGG + Intronic
1130000255 15:80039798-80039820 CTCACATCACACCTAACTGAGGG - Intergenic
1130110867 15:80963796-80963818 CTCTCAACAAACTATATTGATGG + Intronic
1133276393 16:4640722-4640744 CACACAAAAAACCACACCCAAGG - Intronic
1133971488 16:10571374-10571396 CTCACCACCAACCACACTGGGGG + Intronic
1135903740 16:26491069-26491091 CCCTCAACAAACAACACTGTGGG + Intergenic
1136404281 16:30034875-30034897 CTCACAAAAGACCCCACTGTTGG + Intronic
1137254446 16:46763496-46763518 CCCAAAACAACCCACAATGAAGG + Intronic
1138308224 16:55998479-55998501 CTCAAAAGAAAACACACAGATGG - Intergenic
1140951259 16:79819970-79819992 CTCACACCACACCAAACTGATGG - Intergenic
1141505270 16:84472920-84472942 CTGTCAACAAACCAGACAGAAGG + Intergenic
1142520724 17:502887-502909 CTCAAAACCGACGACACTGATGG - Intergenic
1143885749 17:10063666-10063688 CTAACAAGATACGACACTGAGGG + Intronic
1149228238 17:54500285-54500307 ATCACAACAATCCACACTGATGG + Intergenic
1149556730 17:57578700-57578722 ATCACACCAACCCACACTGCTGG - Intronic
1153242292 18:3042023-3042045 GTCACAACAAAGCAAAGTGAAGG + Intergenic
1153814394 18:8780198-8780220 TTCACCACAAACCCCACGGAAGG - Intronic
1155305183 18:24471719-24471741 ATCACAACCAAGCACACAGATGG - Intronic
1157542921 18:48524907-48524929 CTCACCACACACCACACGGAGGG + Intergenic
1158059977 18:53328403-53328425 CTCACAAAAACCCACTGTGATGG - Intronic
1158795282 18:60838495-60838517 CTCACAACAAAACATACACAGGG - Intergenic
1160261536 18:77298914-77298936 CTCACAGCAATCCCCAATGAGGG - Intergenic
1162935087 19:13978215-13978237 CTCTCAACAAAACACCCTGGAGG + Intronic
924968490 2:100849-100871 CTCACAGCCCACCACACCGACGG - Intergenic
925195923 2:1925714-1925736 CTAATCACAAAGCACACTGAGGG + Intronic
925488549 2:4365814-4365836 CACACAACATACCAAACTGATGG - Intergenic
925769324 2:7267075-7267097 TTCAGAGCAAACCACATTGAGGG - Intergenic
929905219 2:46039870-46039892 CCCACAAATAACCCCACTGAGGG - Intronic
930235006 2:48880396-48880418 CTCACAACTAAACAAACTAAGGG - Intergenic
934168272 2:89316884-89316906 CTCAGAAGAAACAAAACTGAAGG - Intergenic
934199015 2:89865698-89865720 CTCAGAAGAAACAAAACTGAAGG + Intergenic
934683357 2:96302468-96302490 CTCACAACAATTAACACAGAAGG + Intronic
936859817 2:117003346-117003368 CCCAGAACACAGCACACTGATGG - Intergenic
939080646 2:137657201-137657223 CTCACAAATAACAACACTCAGGG - Intronic
942583857 2:177452665-177452687 ACCACAATAAATCACACTGAAGG - Intronic
943841640 2:192590907-192590929 CTCAGAAAACACCACAATGATGG + Intergenic
945678361 2:212882516-212882538 GTCAACACAAACCACATTGAAGG + Intergenic
947096885 2:226576790-226576812 CTCACAAAAATCCACCGTGAGGG + Intergenic
1169879202 20:10328524-10328546 ATCACAACAAAACAAACTGCAGG + Intergenic
1172324659 20:34025072-34025094 CTCACAACCGACCACACACAGGG - Intronic
1174890883 20:54390896-54390918 CTCACAACTAAGCAGACTGTTGG + Intergenic
1179131115 21:38638249-38638271 CTCACAACAACCCACTGGGAGGG - Intronic
1179219408 21:39393104-39393126 CACACAACCGACCACACAGAAGG - Intronic
1183879841 22:40818371-40818393 CTCATAACAAACCACACTTGTGG + Intronic
1184702294 22:46183840-46183862 CACACAGTAAACCACACAGAGGG + Intronic
953880174 3:46687350-46687372 ATCACAACCATCCACCCTGAAGG + Intronic
953880774 3:46690342-46690364 ATCACAACCATCCACCCTGAAGG + Intronic
955380956 3:58437583-58437605 CTCAAAACAAACAAGAGTGATGG - Intergenic
956448822 3:69352800-69352822 CTCACCACAAACTAGACTGGAGG + Intronic
958443449 3:94184757-94184779 CTCACAGCAACCCTCAATGATGG - Intergenic
958867414 3:99517326-99517348 CTTACAACAAAACTCTCTGAAGG + Intergenic
959611429 3:108299508-108299530 CTCAGAACATACTACTCTGACGG - Intronic
963557602 3:146812645-146812667 CTAAAAATAAGCCACACTGAAGG + Intergenic
964098526 3:152962326-152962348 CTCACATCCAGTCACACTGATGG + Intergenic
964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG + Intergenic
972243573 4:37220780-37220802 ATCAAAGCAAACAACACTGATGG + Intergenic
972594047 4:40514652-40514674 CTCAGAGCAAACACCACTGAGGG + Exonic
977668311 4:99666868-99666890 ATAGCAACAAACAACACTGATGG - Intergenic
977936662 4:102813782-102813804 GTCACAATAAACAACACTGCAGG + Intronic
980382778 4:132045906-132045928 CTGCCAACTAACCACACTGTAGG + Intergenic
982602056 4:157464320-157464342 CTCAAAACAAACCAGATTTATGG + Intergenic
984178255 4:176447274-176447296 CTTATAACAACCCTCACTGAGGG - Intergenic
984750570 4:183269097-183269119 CTTACAACAGAAGACACTGAGGG + Exonic
987285499 5:16452164-16452186 CTCACAAGCAGCCACAGTGAAGG + Intronic
992152007 5:73914218-73914240 CTCACAACAACCCACTGAGATGG + Intronic
993117374 5:83734377-83734399 CTGACTACAAGCCACAGTGATGG - Intergenic
993558872 5:89378144-89378166 CTCAAAATAAACAACACAGATGG - Intergenic
995649679 5:114356269-114356291 CTCACAACAAGCCATATGGAAGG - Intergenic
999346636 5:150828020-150828042 CCCACAACAAACTTCATTGAAGG - Intergenic
1001839892 5:174866252-174866274 CTTACAACAAACCTACCTGATGG + Intergenic
1002938899 6:1698936-1698958 CTCACAACAAGCCACAGTCATGG + Intronic
1003522970 6:6874261-6874283 CTCAAATGAAACCACACTGGAGG + Intergenic
1005379532 6:25218703-25218725 ATCACACCAAACCAGTCTGAGGG + Intergenic
1007147566 6:39651431-39651453 CTCAGCACCCACCACACTGACGG - Intronic
1010769570 6:79812753-79812775 CTCACAACAAACCACCCAGAGGG + Intergenic
1011592347 6:88982334-88982356 TTCTCAACCAACCACACTGTGGG + Intergenic
1012739047 6:102990795-102990817 CTCAAAAGAAACCACACAAATGG - Intergenic
1013753265 6:113431779-113431801 GTCAAAACAAATCACAGTGATGG + Intergenic
1015720556 6:136236806-136236828 CTCACCGAAAACCTCACTGAGGG + Intronic
1015861677 6:137687718-137687740 ATCACATCAAACCACACTCAGGG + Intergenic
1017793297 6:157820641-157820663 TTCACAATAAGCCACACCGAAGG - Intronic
1021137210 7:16980043-16980065 CTGCCAGCAAATCACACTGAAGG - Intergenic
1022228665 7:28391619-28391641 GTCACCAAAAAGCACACTGAGGG - Intronic
1022500968 7:30882212-30882234 CTCACTGCAAACCACCCAGATGG - Exonic
1022739463 7:33107684-33107706 CTCACATCAAACCTCCCAGAAGG + Intronic
1024048498 7:45601376-45601398 CCCACAACCAGCCACACTCAGGG - Intronic
1025218334 7:57080211-57080233 TTCACCAAGAACCACACTGATGG - Intergenic
1025629253 7:63253830-63253852 TTCACCAAGAACCACACTGATGG - Intergenic
1025653012 7:63490250-63490272 TTCACCAAGAACCACACTGATGG + Intergenic
1030745177 7:113156422-113156444 CTCATAACAAACCACAGAGGAGG - Intergenic
1031112401 7:117627696-117627718 CTCACAGCAAAATACACAGAAGG + Exonic
1031564182 7:123274491-123274513 CTCACAATAATCCATACTGCAGG - Intergenic
1033905931 7:146203081-146203103 ATCACAACAATCAACACAGAAGG + Intronic
1037854853 8:22364357-22364379 GTCACCACAAACCGCACAGAGGG + Intergenic
1038731190 8:30129240-30129262 CTCAGAACATAACACAGTGAGGG - Intronic
1038822784 8:30968135-30968157 CTCACAACAGTCCAGAATGATGG - Intergenic
1038829672 8:31043159-31043181 CATACAAGAAACCACCCTGAAGG - Intronic
1039705737 8:40005533-40005555 TGCACAACAAATAACACTGAGGG + Intronic
1046633835 8:116650064-116650086 TTCACAACAAACTACATTGCTGG - Intronic
1047496889 8:125414968-125414990 CAGACAACAACACACACTGAGGG - Intergenic
1047909842 8:129516032-129516054 CTCATAACAAACCACATATATGG + Intergenic
1048190833 8:132286865-132286887 CTCATAACAACCCACTCTCATGG - Intronic
1054880791 9:70142616-70142638 CTCACCAGAAACCACCCTGATGG - Intronic
1059404270 9:114090247-114090269 CATTCAACAAACAACACTGATGG - Intronic
1060487157 9:124055009-124055031 ATCCCAACAAACCACAAAGAGGG - Intergenic
1186316830 X:8379693-8379715 CTCACAACAAACCTATGTGAGGG - Intergenic
1188090947 X:25964672-25964694 CTCACCAGAAACCAAACAGACGG + Intergenic
1188091973 X:25975849-25975871 CTCACAACAATCAACATTGAAGG - Intergenic
1188649676 X:32616549-32616571 CTCTAAACAAAAAACACTGATGG - Intronic
1195556417 X:106230191-106230213 AACACAACATACCACACTTATGG - Intergenic
1195902968 X:109817774-109817796 CTTACAACAAACCTCACAGATGG - Intergenic
1195903804 X:109824870-109824892 CTTTCAACAAACCTCACAGATGG + Intergenic
1199517085 X:148690192-148690214 CTCACTACAAACTGCAGTGAAGG - Intronic
1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG + Intergenic