ID: 914580663

View in Genome Browser
Species Human (GRCh38)
Location 1:149016528-149016550
Sequence CTGTGGGTTTGGAGTTAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 2, 1: 1, 2: 2, 3: 13, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914580663_914580668 -1 Left 914580663 1:149016528-149016550 CCAGCTTAACTCCAAACCCACAG 0: 2
1: 1
2: 2
3: 13
4: 178
Right 914580668 1:149016550-149016572 GGTAAAGCACAAAGCAGAGATGG 0: 2
1: 0
2: 1
3: 39
4: 355
914580663_914580670 26 Left 914580663 1:149016528-149016550 CCAGCTTAACTCCAAACCCACAG 0: 2
1: 1
2: 2
3: 13
4: 178
Right 914580670 1:149016577-149016599 CTTTGAAAAGAAGTCTCATTTGG 0: 2
1: 1
2: 3
3: 28
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914580663 Original CRISPR CTGTGGGTTTGGAGTTAAGC TGG (reversed) Exonic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903137506 1:21318982-21319004 CTGTGGGTTTTCAGTGGAGCTGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
907543138 1:55234735-55234757 CTGTGGGTTTGGTTTTAGTCTGG + Intergenic
908403921 1:63795218-63795240 TTGTGGCTTTGGAGCTATGCCGG + Intronic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913196899 1:116464590-116464612 CACAGGATTTGGAGTTAAGCAGG - Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914395946 1:147268635-147268657 CTGTGTAATTGGTGTTAAGCAGG + Intronic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914666557 1:149837643-149837665 ATGTGGTTTTGGAAATAAGCTGG + Intergenic
914669210 1:149856155-149856177 ATGTGGTTTTGGAAATAAGCTGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917546582 1:175975309-175975331 GTGTGAGTTTGGAGTTAATATGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924275461 1:242381777-242381799 CCGTGGGTTTGGAGTTAAGTGGG - Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063244642 10:4205591-4205613 CGGGGGATTTGGAGATAAGCAGG + Intergenic
1063964466 10:11335962-11335984 CTATGGGTATGAATTTAAGCAGG - Exonic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065510191 10:26470770-26470792 CCGTGGGTTTGGATAGAAGCAGG - Intronic
1066448854 10:35509916-35509938 CTGTGAGCTGGGAGTTCAGCAGG + Intronic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1070080701 10:73183857-73183879 CAGTAGGTTTGGAGTGAACCTGG + Intronic
1073394899 10:103209536-103209558 TTGGGGTTTTGGAGATAAGCTGG - Intergenic
1073891627 10:108109431-108109453 TTGTGGGTTTTGATTTAGGCTGG - Intergenic
1074269688 10:111941734-111941756 CCATGGGTTTGGAGAAAAGCAGG - Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1084487243 11:69455767-69455789 CTGTGGCTTGGGAGTCAGGCAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085498755 11:76997451-76997473 CTATGGTTATGGATTTAAGCTGG + Intronic
1087973308 11:104512663-104512685 CTGTGGGTCTGCTGTTTAGCTGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089373686 11:117979207-117979229 CTGTTGGTTTTGAGGTAACCAGG + Intergenic
1089622081 11:119728036-119728058 CTGCGGGTTTGGAGTATGGCGGG - Intronic
1091406570 12:213202-213224 ATGTGGGTGTGGACTGAAGCAGG - Intronic
1093277447 12:17147706-17147728 CTATGTGGTTGAAGTTAAGCTGG + Intergenic
1095959556 12:47825618-47825640 CTCAGGGTTGGGAGTGAAGCTGG - Intronic
1097650906 12:62296303-62296325 CTGTGGGTCAGTAGTTAAGGAGG - Intronic
1097768054 12:63548100-63548122 CTGTGGGTTAGGAATTAGGTGGG - Intergenic
1097784415 12:63743166-63743188 CTGTGGGTTAGGAATTAGGTGGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1100614626 12:96221454-96221476 CGGTGGGTTTGGAGGTCTGCAGG - Intronic
1100715324 12:97299615-97299637 CAGTGGATTTGGAATTAAGGTGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1102655927 12:114482169-114482191 CATGGGGTTTGGAGTTATGCTGG + Intergenic
1103722705 12:122983094-122983116 CTCTGGGTTTGGGGTTCAGCTGG - Intergenic
1104426903 12:128685355-128685377 TTATGGGTTTGCAGGTAAGCGGG + Intronic
1108665260 13:52623823-52623845 CTGTGGGTTAGCAGTTTGGCTGG + Intergenic
1111096149 13:83517654-83517676 CAGTGGGTTTGTAGTCTAGCTGG - Intergenic
1111372545 13:87335936-87335958 CTGAGAGTTTGGAGATAACCTGG + Intergenic
1113069943 13:106410547-106410569 ATGAGGGGTAGGAGTTAAGCTGG + Intergenic
1113389901 13:109885464-109885486 GTGTGGCTTTGGAGTCAGGCTGG - Intergenic
1113667924 13:112153844-112153866 CTGTGTGTTTGTAGATAAACAGG + Intergenic
1114452516 14:22836668-22836690 CTGTCGGCTTGGAGTTAAAGGGG - Exonic
1114884240 14:26827773-26827795 CTGTGAGTTTGCAGGTTAGCTGG - Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1118147280 14:63153297-63153319 CTGTGGTTTTGCTGTTAATCAGG + Intergenic
1120456790 14:84740942-84740964 CCCTGGATTTTGAGTTAAGCAGG + Intergenic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1120831767 14:89003797-89003819 CTGTGGCCTTGGAGATCAGCAGG - Intergenic
1121777849 14:96602618-96602640 CAGTGCATTTGTAGTTAAGCAGG + Intergenic
1124406913 15:29401098-29401120 CTCTGGGTTTGCAGGTCAGCTGG - Intronic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1128614575 15:69099189-69099211 CTGTGGGTTGGGCCTCAAGCTGG - Intergenic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1129658538 15:77540538-77540560 CTGTGGGCTGGGAGCTAGGCTGG - Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130298876 15:82665519-82665541 CTGTGGCCTTGGCATTAAGCAGG + Exonic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131645395 15:94336783-94336805 CTGTGTGTTTGGAATGGAGCAGG + Intronic
1138552757 16:57756442-57756464 CTGTGGGTGTGGATATCAGCAGG + Exonic
1140132973 16:72180283-72180305 CTGTGGCTTTGCAGAAAAGCAGG - Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1151560755 17:74868236-74868258 CTCTGGGCTTGGAGTCAAACAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1156053955 18:32974987-32975009 CTATCGGTTTTGAGTTAAACTGG - Intronic
1156147288 18:34199510-34199532 CTGTGGATTCAGAGTTAAGTTGG - Intronic
1156694115 18:39746393-39746415 CTGTGGGTCTGTACTTATGCCGG + Intergenic
1157577551 18:48753874-48753896 CTGCGGGTTTGGGGTTTGGCTGG - Intronic
1159940448 18:74402994-74403016 CTCGGGCTTTGGAGATAAGCAGG - Intergenic
1161560829 19:4971633-4971655 CTGTGGGTTTAGAGTGTAGTGGG + Intronic
1161753981 19:6117979-6118001 ACCTGGGTTTGGAGTTAAACAGG + Intronic
1163260719 19:16188255-16188277 CTGTTGGGTTGGATGTAAGCTGG + Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165288838 19:34866859-34866881 GAGTGGGTTTGTGGTTAAGCAGG - Intergenic
1165457919 19:35925543-35925565 CTGTTGGTTTCGAGCTCAGCTGG - Intergenic
1166447217 19:42868699-42868721 CTGGTGGTTTGGATTTAAGCTGG + Intronic
1166451685 19:42907519-42907541 CTGGTCGTTTGGAGTTAAGCTGG + Intronic
1166454136 19:42926371-42926393 CTGGTCGTTTGGAGTTAAGCTGG + Intronic
1166463925 19:43015714-43015736 CTGGTCGTTTGGATTTAAGCTGG + Intronic
1166483685 19:43194938-43194960 CTGGTGGTTTGGATTTAAGCTGG + Intronic
1166490795 19:43258800-43258822 CTGGTCGTTTGGACTTAAGCTGG + Intronic
1166531356 19:43545463-43545485 CTGTTGGTCTGGGGTGAAGCCGG - Intronic
1167851586 19:52206319-52206341 CTGTGGGTTTAGAGTCAGGTTGG + Intronic
928979768 2:37125600-37125622 CTGTGGGCTGGAAGTTCAGCTGG - Intronic
931297171 2:60938606-60938628 CAGTGGGTTACGAGTGAAGCCGG + Intergenic
931376598 2:61713602-61713624 CCGTGGGTTTGGAGTGAATGAGG + Intergenic
931746143 2:65293551-65293573 CTGCGGCTGTGGAGTTCAGCAGG + Intergenic
934076911 2:88436388-88436410 CTGTGGCCTGGGAATTAAGCTGG - Intergenic
935356880 2:102209594-102209616 CTGAGGTCATGGAGTTAAGCAGG + Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937712101 2:124989923-124989945 CTGTGAGGTAGGAGTTCAGCAGG + Intergenic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
947350737 2:229242281-229242303 CTGTGAGTTTTGATTTTAGCTGG - Intronic
1169092597 20:2870819-2870841 CTGTGGGTTGGGACTAATGCAGG + Intronic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170574074 20:17649541-17649563 CGCTGGGTTTGGAGCAAAGCAGG + Intronic
1170589566 20:17761638-17761660 GTGTGTGTTTGAAGTTAATCTGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1175862138 20:62156232-62156254 CTGGGGGTTAGGAGTCAAGGAGG + Intronic
1179052689 21:37902059-37902081 CTGAGAGATTGGAGTTAACCTGG - Intronic
1179398749 21:41064755-41064777 CTGTGGGTTTGGAGTTGGCCTGG - Intergenic
1180080408 21:45484802-45484824 ATGTAGGCTTTGAGTTAAGCAGG + Intronic
1181548561 22:23620981-23621003 CTGTGAGGATGGAGTTCAGCGGG - Intronic
1182791888 22:32960061-32960083 CTGAGGCTTTGGAGTTAGACAGG + Intronic
1183049569 22:35249957-35249979 CTGAGGGTTTGTACTTAACCTGG - Intergenic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184541536 22:45128834-45128856 CTGTGGATTTTGAGTAAAGTGGG - Intergenic
950504435 3:13385629-13385651 CTGTGGGCTTTGTGTTTAGCTGG - Intronic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
951151491 3:19295701-19295723 CTGTGGGTTTGTACTTCAGTGGG + Intronic
954887305 3:53887037-53887059 ATGTGGGTTAGGAGCTAAGTGGG - Intronic
957789094 3:84917261-84917283 CTGTGGGATAGCAGTTAAGTGGG - Intergenic
957951111 3:87128027-87128049 CTGTTGGTTGGGAGTTCAGCTGG + Intergenic
961431592 3:126887885-126887907 GAGTGGGTGTGGATTTAAGCTGG - Intronic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
962369154 3:134806393-134806415 CTGTGGGCTGGGACTTGAGCTGG - Intronic
966113711 3:176434769-176434791 CTGGGTGTTGGGAGTTAAGATGG - Intergenic
966775442 3:183539332-183539354 CTGTCAGTTTGGAGCAAAGCTGG - Intronic
969078060 4:4596344-4596366 CAGAGGGTTTGGAGGTAATCTGG - Intergenic
969963963 4:10975272-10975294 CTGAGGGATGGGAGCTAAGCTGG - Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
977718452 4:100210107-100210129 TTGAGGGATTGGAGCTAAGCTGG - Intergenic
982688460 4:158521234-158521256 CTGTGACTTTAGAGTTATGCAGG - Intronic
987231725 5:15900988-15901010 ATGTGTTTTTGAAGTTAAGCAGG - Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
991304204 5:65159438-65159460 CGGTGGGTTGGGAGATGAGCAGG - Intronic
994238103 5:97389377-97389399 CTGTGTGTTTTCAGTTAGGCTGG - Intergenic
994299848 5:98134772-98134794 CTGTGGGTTTGGCTTTACTCAGG - Intergenic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
997304779 5:132829397-132829419 ATGTGGCTCTGGAGTTCAGCAGG + Intronic
999192403 5:149758057-149758079 GTGTGGGTTTGGAGGTGGGCAGG - Intronic
1003378093 6:5597563-5597585 CTGTGAGTTTGGAGTGCTGCTGG - Intronic
1003880062 6:10471845-10471867 CTGTCAGTTGGGAGCTAAGCTGG + Intergenic
1006337274 6:33427390-33427412 GTGTGTGTTTGGAGTTGAGGTGG + Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1007885871 6:45229664-45229686 ATGTGGGCTTAGAGTTAGGCTGG - Intronic
1011708237 6:90024951-90024973 ATGTGGCTCTGGAATTAAGCGGG + Intronic
1012042951 6:94233825-94233847 CTGGGGGTTTGGAGTTTATATGG - Intergenic
1015798865 6:137040861-137040883 GTGTGAGTTTGGGGATAAGCAGG + Intronic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019431831 7:1002905-1002927 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432079 7:1003795-1003817 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432097 7:1003863-1003885 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1021250651 7:18321257-18321279 CTGAAGGTCTGGAGTTAACCAGG - Intronic
1021560479 7:21964571-21964593 CTGGGGGTTTGGGGTTAATATGG - Intergenic
1023433196 7:40115562-40115584 CACTGGGTTTGGAGTCTAGCTGG + Intergenic
1024453977 7:49581671-49581693 CTGTGGCTTTGGAATGAAGGTGG - Intergenic
1024845539 7:53637384-53637406 CTCTGACTTTTGAGTTAAGCTGG + Intergenic
1024847347 7:53662377-53662399 CTGTGGGGTTAGAGTGAAGGAGG - Intergenic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1031671531 7:124553099-124553121 ATGATGGTTTGGAGTTGAGCAGG + Intergenic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1036459483 8:8939113-8939135 CTGTGGGTTTAGAGTTGCCCTGG - Intergenic
1046583859 8:116127031-116127053 CTGTGGGATAGAAGTTAAACAGG - Intergenic
1048705858 8:137152952-137152974 CTGTGTGTTTGTAGTTAAAGTGG + Intergenic
1048953357 8:139514182-139514204 TTGAGGGTTTGGAGTAAAACTGG + Intergenic
1050203700 9:3175982-3176004 TGGTGGGTTTTGAGTGAAGCAGG - Intergenic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060776148 9:126376427-126376449 TTGTGGGTTGGGATTTAAGATGG + Intronic
1187429539 X:19209621-19209643 CTGTTGGCTGGGAGTTCAGCTGG + Intergenic
1193488263 X:82115077-82115099 CTATTGGATTGGAGCTAAGCTGG + Intergenic
1195644218 X:107209981-107210003 CTGTGGGTCTGGAGCCAATCTGG + Intronic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic