ID: 914580684

View in Genome Browser
Species Human (GRCh38)
Location 1:149016670-149016692
Sequence AAAATGCAAGAGCTGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914580677_914580684 9 Left 914580677 1:149016638-149016660 CCTCCTCCATCCCTGGCTCACAG 0: 3
1: 0
2: 12
3: 95
4: 752
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580675_914580684 29 Left 914580675 1:149016618-149016640 CCAGGCAGGACTATTTCATTCCT 0: 2
1: 1
2: 0
3: 7
4: 174
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580680_914580684 3 Left 914580680 1:149016644-149016666 CCATCCCTGGCTCACAGAGTGGA 0: 2
1: 1
2: 2
3: 28
4: 319
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580681_914580684 -1 Left 914580681 1:149016648-149016670 CCCTGGCTCACAGAGTGGATATA 0: 2
1: 0
2: 0
3: 6
4: 111
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580674_914580684 30 Left 914580674 1:149016617-149016639 CCCAGGCAGGACTATTTCATTCC 0: 2
1: 1
2: 0
3: 10
4: 170
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580682_914580684 -2 Left 914580682 1:149016649-149016671 CCTGGCTCACAGAGTGGATATAA 0: 2
1: 0
2: 0
3: 13
4: 183
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237
914580678_914580684 6 Left 914580678 1:149016641-149016663 CCTCCATCCCTGGCTCACAGAGT 0: 3
1: 1
2: 6
3: 61
4: 697
Right 914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG 0: 2
1: 0
2: 1
3: 14
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914580684 Original CRISPR AAAATGCAAGAGCTGTATCA GGG Intronic
902717652 1:18283480-18283502 GAACTGCAAGAGCGGTTTCAGGG + Intronic
903955057 1:27019757-27019779 AAAATGCAGTAGCTTGATCATGG + Intergenic
904535114 1:31194330-31194352 AAAAAGAAAGAGCTGGGTCAGGG - Intronic
905725270 1:40246018-40246040 AAAATCCAAAATCTGTAACATGG - Intronic
906342271 1:44990990-44991012 AAAGTGCAAGTACTGTAACAAGG - Intergenic
906434439 1:45783028-45783050 AAAATTTAGGAACTGTATCACGG + Intergenic
909164540 1:72202542-72202564 AAAGTGCAATAGCTTTATTATGG + Intronic
909851509 1:80470659-80470681 AAAATCCAAAATCTTTATCACGG + Intergenic
909867994 1:80698840-80698862 AAAAAACTAGAGCAGTATCATGG + Intergenic
910245763 1:85136443-85136465 AAAATGCTAGAGCTGCCTAATGG + Intergenic
911108684 1:94160609-94160631 AAAATGAAAGAGATGTTTCTAGG - Intronic
911990094 1:104685163-104685185 AAAAGGACAGAGCTGCATCAGGG - Intergenic
912570350 1:110616732-110616754 AAAAGGCAGGAGCTGAGTCATGG + Intronic
912734220 1:112135726-112135748 AATATGCAGGAGCTGAACCATGG + Intergenic
913561597 1:120026653-120026675 AAAAAGCAAGAACAATATCAAGG - Intronic
913610506 1:120505569-120505591 AAAATGCAAGAGCTGTATCAGGG - Intergenic
913636526 1:120766945-120766967 AAAAAGCAAGAACAATATCAAGG + Intergenic
913984294 1:143551247-143551269 AAAATGAAAGACCTGTATCAGGG + Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914282185 1:146186063-146186085 AAAAAGCAAGAACAATATCAAGG - Intronic
914543214 1:148636774-148636796 AAAAAGCAAGAACAATATCAAGG - Intronic
914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG + Intronic
914623411 1:149434239-149434261 AAAAAGCAAGAACAATATCAAGG + Intergenic
914957019 1:152172062-152172084 AGAATGTAAAAGCTGTATGAGGG - Intergenic
916571953 1:166035822-166035844 TAAATGCAAGAGCTTGGTCAAGG + Intergenic
918444282 1:184601283-184601305 TAAATGCAAAGGCTGCATCAAGG - Intronic
919675645 1:200380013-200380035 AAAATGGAATAGCAGTATTATGG + Intergenic
921490185 1:215765995-215766017 AAAATAGAACAGCTGTATCATGG + Intronic
923023051 1:230180271-230180293 AAAGTGTAAGAGCTGTGTCTAGG + Intronic
1064703155 10:18043053-18043075 AAAAAGCAAGAGCTTCATCATGG - Exonic
1065206379 10:23361412-23361434 AAAAACCAAGAGATGTGTCAGGG - Intergenic
1067922221 10:50470976-50470998 AAAATGTGGGAGCTGAATCAGGG + Intronic
1068222443 10:54061414-54061436 ATAATGGAAGAGCTGTTTAAAGG - Intronic
1069032277 10:63609895-63609917 AAAATGTAAAAGATGTATGATGG - Intronic
1069180274 10:65350489-65350511 ATAAAGCAAGAGCTTAATCAAGG + Intergenic
1073592500 10:104770247-104770269 AAAGTGCAGGAGCTGAATAAAGG + Intronic
1073917192 10:108419184-108419206 AAAATGTAAGAACTGTATAGAGG + Intergenic
1074297347 10:112202797-112202819 AAAAGGCAAGATATGAATCACGG + Intronic
1078746738 11:14122914-14122936 AAATTACAAGAGCAGTATAAAGG - Intronic
1079329770 11:19523695-19523717 ACATTGCAAGAGCTTGATCAAGG + Intronic
1079387359 11:19992438-19992460 AAAAGGAAAGAGCTGTATGGTGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079498783 11:21077440-21077462 AAAATTCAAGAGCAGAATTAGGG + Intronic
1079792931 11:24761541-24761563 CTAATGCCAGAGCTGTATCCAGG + Intronic
1080329297 11:31117111-31117133 AAAATGCCACAGCTGCATGAGGG + Intronic
1082205767 11:49432235-49432257 AAACTGCAAGAAATGTAGCATGG + Intergenic
1084603018 11:70157589-70157611 AAAATGAAAGCTGTGTATCAGGG - Intronic
1085367415 11:75963145-75963167 AATATGCAAAATATGTATCATGG - Intronic
1089960453 11:122613277-122613299 AAAAGGAAATAGCTGGATCAAGG - Intergenic
1090137827 11:124217515-124217537 AAAAGGCAGTAGCTTTATCAAGG + Intergenic
1090412995 11:126521618-126521640 CAAATGCAAGAGCTTTCCCAAGG + Intronic
1093752368 12:22815001-22815023 AAAATGAAAAAGCAGTCTCAAGG - Intergenic
1095314031 12:40737062-40737084 AAAATTCAAAAACTTTATCATGG + Intronic
1096663475 12:53145450-53145472 AATATGTAAGAGATTTATCACGG + Intergenic
1100271970 12:93034570-93034592 GAAATGAAAGAACTGTGTCAAGG + Intergenic
1100962966 12:99984341-99984363 ATAATGCAAGAGCTTCAGCACGG + Intronic
1101435965 12:104664809-104664831 AAATTGCAAGAACTGTTTCATGG + Intronic
1101651602 12:106682178-106682200 AATATGGAAGAGCTTTATGACGG + Intronic
1101765294 12:107692564-107692586 CCAATGAAAGAACTGTATCAGGG - Intronic
1101837377 12:108304883-108304905 CAAATGCAGGGGCTTTATCAGGG + Intronic
1103990090 12:124793094-124793116 AAAATGCAAGGGCGGGATGAAGG + Intronic
1104019507 12:124982233-124982255 AAGCTGGAAGAGCTGTAACAAGG + Intronic
1104732285 12:131114402-131114424 CATTTGCAAGAGCTGTGTCAGGG - Intronic
1105022450 12:132826260-132826282 AAACTGGAAGAGCAGCATCACGG + Intronic
1105959692 13:25320501-25320523 AAAATGCAAAACATGTATTAAGG - Intronic
1106905954 13:34408954-34408976 GAAATACAAGAGATTTATCAGGG + Intergenic
1107190329 13:37576372-37576394 TAAATGTTAGAGCTGTTTCAAGG + Intronic
1107495816 13:40924605-40924627 AAAAAAAAATAGCTGTATCATGG + Intergenic
1110313316 13:74076158-74076180 AAAATATAATAGCTTTATCAAGG - Intronic
1111494827 13:89034324-89034346 AGAATGCAAGAGCTGTGGCTTGG + Intergenic
1112766082 13:102745451-102745473 AAAATGAAAGAACTGCATCAAGG - Exonic
1113374020 13:109747012-109747034 AAAATGCTAAAGCTGAATGACGG + Intergenic
1114793907 14:25690363-25690385 CAAGTGCCACAGCTGTATCAAGG + Intergenic
1116242164 14:42358554-42358576 AAATTGAAAGATCTATATCATGG - Intergenic
1118696760 14:68393598-68393620 AAAAGGCAAGGTCTTTATCATGG + Intronic
1120098822 14:80420907-80420929 ACATTACAAGAGCTGTTTCATGG - Intergenic
1120382329 14:83796701-83796723 AAAATGGAAGAGCTGTTTAAAGG + Intergenic
1120760561 14:88280963-88280985 AAAATGCAAGCCCCTTATCATGG + Intronic
1120760568 14:88281033-88281055 AAAATGCAAGCCCCTTATCATGG + Intronic
1121213049 14:92223643-92223665 AAAATGCAAGAGTTTTACCCAGG + Intergenic
1122962967 14:105106896-105106918 ATAATGCCAGAGCATTATCAAGG + Intergenic
1124004469 15:25785058-25785080 AAAAGGCAAGAGATGCCTCAGGG + Intronic
1125857250 15:42962330-42962352 AAAAGGAAACAGCGGTATCATGG + Intronic
1127800239 15:62471562-62471584 AAAATCCTAGAGCAGTATGAAGG - Intronic
1127941613 15:63703522-63703544 TAAATGCAAATGCTGTATGAGGG + Intronic
1128471325 15:67956259-67956281 AAAATGCAAGATTGGTATGAAGG + Intergenic
1130346169 15:83047583-83047605 AAAATGTAGGTGCTATATCAGGG + Intronic
1131909480 15:97181433-97181455 GAAATATAAGAGCTGTATCAGGG - Intergenic
1133157029 16:3882384-3882406 CAGATTCAAGAGCGGTATCACGG - Intergenic
1139247318 16:65458086-65458108 AAAATGCAAAATGCGTATCAGGG - Intergenic
1140563833 16:76016408-76016430 AAAATGCTAGAGCTGTAGAAGGG - Intergenic
1140690377 16:77477873-77477895 AAAATTCAAGTGCTGAATCTTGG - Intergenic
1142439416 16:90085816-90085838 AAAATGCAAGAGCTGAGACTTGG + Intronic
1144515167 17:15912392-15912414 AAAATGCAGGTGGTGTTTCAGGG + Intergenic
1147592341 17:41692230-41692252 TAAATGCAAGGGCTATAACAAGG + Exonic
1148016137 17:44523934-44523956 CAAATGCAAAAGCTGGATAAAGG + Intergenic
1148329914 17:46807775-46807797 AAAACGGAAGAGCAGGATCAGGG + Intronic
1148642680 17:49200270-49200292 AAAATTCAAGAGGTGTAAAAGGG - Intergenic
1151494581 17:74451870-74451892 AAAAAGCAAGAGGTCTAGCAGGG - Intergenic
1152620434 17:81361535-81361557 AAAAGGCAAGAGATGGCTCAAGG - Intergenic
1153620015 18:6968415-6968437 AAAATGCATGGGCTGTGGCAAGG - Intronic
1156947000 18:42845181-42845203 AAAATGGAAGAGATTTTTCAGGG + Intronic
1157801503 18:50625231-50625253 AAAATGCAGGGTCTGCATCAGGG + Intronic
1157967937 18:52229864-52229886 AAAATGTAAGAGTTGGATGAGGG + Intergenic
1159363265 18:67432458-67432480 TAAATGTAAGAGCTATTTCACGG + Intergenic
1159513578 18:69428359-69428381 TAAATGCTAAATCTGTATCATGG - Intronic
1160815965 19:1035937-1035959 AAACTGAAACAGCTGTATGATGG + Intronic
1165071714 19:33259616-33259638 CAGATCCAGGAGCTGTATCATGG - Intergenic
1165960291 19:39528451-39528473 AATATGCAAGACCTATATGAAGG + Intergenic
1166334488 19:42097048-42097070 AAAAAGCAACAGCTCTATCTGGG + Intronic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
928903385 2:36345039-36345061 AAAATGAAAGAGTTGGATCTGGG + Intergenic
930088748 2:47516870-47516892 AAAGTGCCAGAGCTGCTTCAGGG + Exonic
933177048 2:79186595-79186617 ACAATGAAAGACCTGTATCCAGG + Intronic
935733142 2:106082827-106082849 AAAATGCAAGTGCTGTCTGGAGG - Intergenic
936028908 2:109055741-109055763 AAAATGTTAGAGCTGTCACAAGG - Intergenic
940570008 2:155419073-155419095 AAAAAGAAAGAAATGTATCAAGG + Intergenic
940853610 2:158711672-158711694 AAAGTTCTAGAGCTGTATGATGG - Intergenic
940923011 2:159330945-159330967 AAAATGGAGGAACTGGATCAAGG + Intronic
940994912 2:160137890-160137912 AAAATGCACGAGGTGAAACAAGG + Intronic
941558660 2:167016699-167016721 AAGAAGCAGGAGCTGTAGCAGGG + Intronic
941725433 2:168855066-168855088 AAAATGAAATAGCTATAGCAAGG + Intronic
943690343 2:190863127-190863149 AATATGCCAGAACTATATCATGG - Intergenic
943745672 2:191460510-191460532 AAAAAAAAAGAGCTGTATAAGGG + Intergenic
944922375 2:204428913-204428935 CAAAAGCAAGGGCTGTCTCAGGG - Intergenic
945339714 2:208638596-208638618 AGAATGCAAGAGCATTCTCATGG + Intronic
945446169 2:209941042-209941064 GAAAAGGAAGTGCTGTATCAAGG + Intronic
946784660 2:223230256-223230278 AGAATGTGAGAGCTGTGTCAGGG - Intergenic
1169539750 20:6586633-6586655 AAAAAGAAAGAGCTGTAAGAAGG + Intergenic
1172651339 20:36504338-36504360 AAAATGAAAATGCTGTAACATGG - Intronic
1174022308 20:47540757-47540779 ATAATGCAAGAGGTTTAACAAGG + Intronic
1174868640 20:54163109-54163131 AAAATGCAGAATCTGAATCAGGG + Intronic
1174910956 20:54607080-54607102 AGAATGCAGGAGCTTGATCAGGG + Intronic
1175809824 20:61852036-61852058 AAAAGGGAAGAGCTGAATCTGGG - Intronic
1177000224 21:15603457-15603479 AAAATGGAAGACCTGTATGGTGG - Intergenic
1177441218 21:21128057-21128079 AAAAAGCAAGAACTGTATGTAGG + Intronic
1178912791 21:36689590-36689612 ACAAAGCACGAGCTGTATCTAGG + Intergenic
1182131554 22:27856704-27856726 GAAATGCCAGTGCTGCATCATGG + Intronic
1182395740 22:30034492-30034514 AAAATACAAAAGCTGTAGCTAGG + Intergenic
1184328166 22:43807655-43807677 AAATTGCTGGAACTGTATCATGG + Intronic
1184813016 22:46850015-46850037 CAAATGCAGGAGCTGTTCCAGGG - Intronic
950624989 3:14238699-14238721 GAAATACAAGAGCTCTATTAGGG + Intergenic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
955940663 3:64144431-64144453 ACATTGCAAGAGCTATATAAAGG + Intronic
956087741 3:65630915-65630937 AAAATGCAAGCTCTTTATCATGG - Intronic
958719320 3:97824529-97824551 ATATTGGAAGACCTGTATCAAGG - Intronic
959504125 3:107139285-107139307 AAACTGTAAGAGCTGAATTAGGG + Intergenic
961024649 3:123543544-123543566 AAAATGCAAAAGCTATAAAAGGG - Intronic
961102550 3:124213359-124213381 AATATGCCAGATCTGTATTAGGG + Intronic
961933870 3:130562887-130562909 AAAAAGAAATAGCTGTATCTTGG - Intronic
962995953 3:140628627-140628649 AAAATCCAAGAGACTTATCAAGG - Intergenic
963229858 3:142898715-142898737 AATGTGCAAGAGACGTATCAGGG + Intergenic
963606361 3:147414454-147414476 AATATTGAAGAGCTGTAACATGG - Exonic
964599557 3:158482451-158482473 AAAATCCAAGGGCTGTTTTAGGG - Intronic
965261899 3:166497588-166497610 AAAATTCAAGAGTTGCATTAAGG - Intergenic
965411137 3:168333008-168333030 AGACTGGAAGAGCTGTTTCAGGG + Intergenic
966790686 3:183666807-183666829 AAAATACAACAGTTGTACCAAGG + Intronic
972206174 4:36775437-36775459 AAGAAGCAAGAGCTGTAGGAGGG + Intergenic
973885341 4:55315394-55315416 AATATTCTAGAGCTGGATCATGG + Intergenic
975259488 4:72279842-72279864 AAAATGCAAGATGTGTATAGAGG + Intergenic
975900419 4:79145376-79145398 AAAATGCAGGAGCTATATTAGGG - Intergenic
976887410 4:90002651-90002673 AAAAAGCAATAGCTGGATGAAGG + Intergenic
978395477 4:108274943-108274965 AACATGTAAGTGCTGAATCAGGG - Intergenic
980478795 4:133357487-133357509 AAGATGCAAGAGCTGAGTCCTGG - Intergenic
981505606 4:145496101-145496123 AAAAAACAAGAGTTTTATCAAGG - Intronic
981589675 4:146345865-146345887 AAAGTGCAAGAACAGTATCTAGG - Intronic
982279989 4:153673630-153673652 GAAAAGCAAGAACTGTATTAGGG - Intergenic
982668564 4:158294200-158294222 AAATTCCAAGAGCTGTTTGATGG - Intergenic
985901089 5:2793829-2793851 ATAATGCAAGACCTTTATAAGGG + Intergenic
985934683 5:3087932-3087954 AAAAAGCAAGAGCTGTCTCTGGG + Intergenic
987685597 5:21196394-21196416 AAAATGCAAAGTCTGAATCAAGG - Intergenic
988410978 5:30885310-30885332 AAAATGCATGCCCAGTATCAAGG - Intergenic
988446656 5:31293675-31293697 AAAAGGCAAGAGCAATAGCAAGG - Intronic
989694995 5:44189906-44189928 AAAATGCAATATCTGTTTTATGG - Intergenic
989713504 5:44430496-44430518 AAAAAACATGAGCTGTCTCAGGG - Intergenic
990797266 5:59557838-59557860 AAAAGGCAATAACTGCATCAGGG + Intronic
990906831 5:60812850-60812872 AACAAGCAAGAGCTGAATGATGG - Intronic
991010092 5:61873234-61873256 AAGATCCAAGAGTTGTATAACGG - Intergenic
992085588 5:73275354-73275376 AAAATGGAACAGCTGTAGCTGGG + Intergenic
997311623 5:132889646-132889668 AAAATGAAAAAGCAGTCTCAAGG + Intronic
997569999 5:134919901-134919923 TAAATGCAAGTTCTGTGTCATGG - Intronic
997595130 5:135102260-135102282 AAAATGCAAGAGGTTCAGCAGGG - Intronic
998827926 5:146123915-146123937 AAAATAAAAGAGCTGGATTATGG + Intronic
998843187 5:146278123-146278145 AAAATTCAAGTGCTATATGAGGG - Intronic
999667906 5:153933068-153933090 CAAATTCAAAAGCTGTAACATGG + Intergenic
999669205 5:153944076-153944098 CAAATTCAAGAGCTGTAACATGG + Intergenic
999931284 5:156435457-156435479 AAAATGAAAAATCTGTATGATGG + Intronic
1000846953 5:166293541-166293563 AAAATGCAGAAGATTTATCAAGG + Intergenic
1001967051 5:175917685-175917707 CAGAGGCCAGAGCTGTATCATGG - Intergenic
1002249884 5:177921527-177921549 CAGAGGCCAGAGCTGTATCATGG + Intergenic
1002549553 5:179977082-179977104 GAAATGGCAGAGCTGTGTCAAGG - Intronic
1003179583 6:3780411-3780433 CACATGCAAGAGCTTTATCAAGG + Intergenic
1006207160 6:32357575-32357597 AGAAGGCAAGAGGAGTATCAAGG + Intronic
1006420050 6:33927378-33927400 AAAATGCAAATGCTGTCTGAGGG - Intergenic
1008967305 6:57325785-57325807 AACATGCAAGTCCTCTATCACGG - Intronic
1009900089 6:69799540-69799562 AAAAGCCATGAGCTGTATGAAGG - Intergenic
1011442977 6:87407697-87407719 AAAACGGAAGGGCTGTATCCTGG - Intergenic
1013257705 6:108405715-108405737 AAAATGCTGGAGATGAATCATGG - Intronic
1014638427 6:123878672-123878694 AAACTTCAAGTGCTGTAACATGG + Intronic
1014885680 6:126778125-126778147 TAAAGGCAACAGCTGTTTCAGGG - Intergenic
1015351303 6:132223502-132223524 AAAATGCAATAGATCTGTCAAGG + Intergenic
1017510101 6:155106490-155106512 AAAATGAAAGAACTCTAGCAAGG + Intronic
1018642151 6:165914534-165914556 AACATGCAACAGCTGTACAAAGG + Intronic
1019025587 6:168960293-168960315 AAAATGCAAGACATTTATTAGGG + Intergenic
1019797584 7:3063232-3063254 AAACTGAAAGAGCTGCACCATGG - Intergenic
1020046977 7:5047417-5047439 AAAAAACATGAGCTGTATAATGG + Intronic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1021781326 7:24109461-24109483 AAAATGTAAGAGCCGAGTCAAGG + Intergenic
1022024658 7:26435895-26435917 AGAATTCAAGAGCTGGCTCAAGG - Intergenic
1022027723 7:26464587-26464609 TAAATGCAAGAGGGGTACCAAGG + Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1023586176 7:41732167-41732189 AAAATGAAAGAACTGTGTCTGGG + Intergenic
1027121617 7:75526525-75526547 AAAAATCATGAGCTGTATAATGG - Intergenic
1027769930 7:82393198-82393220 TATATGCAAGTGCTGTTTCAAGG - Intronic
1028763645 7:94524899-94524921 AAAATATAAGAGCTATATAAAGG + Intronic
1030715165 7:112800847-112800869 AAAATGTGAGAGCTGTTCCAGGG - Intergenic
1030922469 7:115408754-115408776 AAAATAAAAAAGCTTTATCATGG - Intergenic
1031395940 7:121273851-121273873 GAAATGCAAGGGCTGTAGCCTGG + Intronic
1032867934 7:135947283-135947305 AAAAGGCAAGAGCTGATCCAAGG - Intronic
1037309657 8:17541675-17541697 AAAATGAAAGAGCTGTACATGGG - Intronic
1038334528 8:26635487-26635509 AAAATGCATGAGGTGCCTCATGG - Intronic
1041457180 8:58073957-58073979 GAAATGCAAGATCTGTTTCCAGG - Intronic
1041868092 8:62599618-62599640 ACTATGCAAGAGCTGTAAAAGGG + Intronic
1044892908 8:96856104-96856126 AAAATGCAAGCTCTGAATCAGGG - Intronic
1046514295 8:115238659-115238681 AAAATGTAAGAGCTGTTTTTAGG - Intergenic
1047697508 8:127417470-127417492 AAAATGAATTATCTGTATCATGG - Exonic
1047824652 8:128560072-128560094 ATAAAGGAAGAGCTGTAACACGG - Intergenic
1047920320 8:129628584-129628606 GAAAAGCAAGAGCTGTGGCACGG - Intergenic
1049393817 8:142387467-142387489 AAAATTCAAAAGCTGAATCTTGG + Intronic
1050615688 9:7399550-7399572 AAAATGCACGAGAGGTATTAAGG - Intergenic
1050856355 9:10361962-10361984 AAAATGAAGGAAATGTATCATGG + Intronic
1052774109 9:32716586-32716608 AAAATCCAAGAACTGTCTCTTGG + Intergenic
1053108638 9:35437584-35437606 AATAAGCAAGAACTCTATCAGGG + Intergenic
1053850672 9:42287651-42287673 AAAATGCAAGAGCACAATTAGGG + Intergenic
1055318284 9:75055956-75055978 GAAAGGCAAGAGCTCTGTCAGGG - Intergenic
1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG + Intergenic
1057325716 9:94061594-94061616 AGAATGCAAGAGCTGAAGCTTGG - Intronic
1057613686 9:96569129-96569151 ACAATGCAAAAGCTGTAAAAAGG - Intronic
1057686007 9:97235547-97235569 AAAAAAAAATAGCTGTATCATGG - Intergenic
1059806869 9:117810876-117810898 AAAATGGAAGATGTGTTTCACGG - Intergenic
1059941216 9:119361779-119361801 AAAATGCAAAAACTGTAGCTGGG - Intronic
1186416589 X:9388763-9388785 AAAAAGCAAGAGCTGACTGATGG + Intergenic
1187943991 X:24408795-24408817 CAAATGTCAGAGCTGCATCATGG + Intergenic
1191823385 X:65337300-65337322 AAAATCCAAGAACTCTCTCATGG - Intergenic
1191971753 X:66824859-66824881 AACCTGCAAGAGCTGTAACATGG - Intergenic
1192130476 X:68545091-68545113 AATATGCAAGAAATGTATTAAGG - Intergenic
1192851875 X:74965431-74965453 AAAATCCAAGTACTGTACCATGG + Intergenic
1197336039 X:125210523-125210545 AAAATCCAAAATCTTTATCAAGG - Intergenic
1197778944 X:130140483-130140505 AACTTGAATGAGCTGTATCAGGG + Intronic
1197960740 X:132003433-132003455 AAAAAGCAACAGCTGTAACTTGG - Intergenic
1198443435 X:136687454-136687476 AAAATGCAAGTGCTTTATATAGG - Intronic
1200109049 X:153729800-153729822 AGGGTGCAAGAGCTGTTTCAGGG - Intronic
1200171467 X:154078609-154078631 AAAAAGAAAGAGCAGAATCAAGG + Intronic
1201426052 Y:13851900-13851922 AACATGCACGAGCTGAAGCAAGG - Intergenic