ID: 914581250

View in Genome Browser
Species Human (GRCh38)
Location 1:149021023-149021045
Sequence GGTCAGACTGCAGCACAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 4, 1: 1, 2: 1, 3: 8, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914581244_914581250 4 Left 914581244 1:149020996-149021018 CCATCTCAGTGGGCCTTGCCTCT 0: 4
1: 0
2: 3
3: 25
4: 281
Right 914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG 0: 4
1: 1
2: 1
3: 8
4: 148
914581246_914581250 -9 Left 914581246 1:149021009-149021031 CCTTGCCTCTCCCTGGTCAGACT 0: 4
1: 2
2: 2
3: 26
4: 324
Right 914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG 0: 4
1: 1
2: 1
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914581250 Original CRISPR GGTCAGACTGCAGCACAAGC TGG Exonic
900088072 1:908171-908193 AGTCGGAGGGCAGCACAAGCCGG + Intergenic
901462397 1:9399555-9399577 CCTCGGACTGCAGCACAGGCAGG - Intergenic
902081077 1:13820948-13820970 GGCCAGTCTGCTGCATAAGCAGG + Intronic
903020066 1:20387361-20387383 GGTCAGGCTGCAACTGAAGCAGG + Intergenic
904669979 1:32156954-32156976 GGTCAGCCTGAGGCACATGCAGG - Intronic
904819306 1:33230682-33230704 GGTTATACAGCAGCGCAAGCTGG + Intergenic
905046040 1:35002873-35002895 GTTAGGACAGCAGCACAAGCTGG + Intronic
905610603 1:39347210-39347232 GGTCAGACTGAACCAGCAGCTGG + Intronic
912435240 1:109656883-109656905 GGACAGCCTGCAGCTCCAGCAGG - Intronic
912442958 1:109712789-109712811 GGACAGCCTGCAGCTCCAGCAGG - Intronic
912627677 1:111219716-111219738 GTGCAGACTGCAACACAAGGAGG - Intronic
912948884 1:114106896-114106918 GGGCATGCTGAAGCACAAGCAGG - Intronic
913271938 1:117102935-117102957 CGTCAAACTGCAGCAAAAACTGG - Exonic
913609939 1:120501218-120501240 GGTCAGACTGCAGCACAAGCTGG - Intergenic
913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG + Intergenic
914576998 1:148981454-148981476 GGTCAGACTGCAGCCCAGGATGG + Intronic
914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG + Exonic
914996486 1:152547168-152547190 GATCCAGCTGCAGCACAAGCAGG - Intronic
920560544 1:206935535-206935557 GGTCAGACACCAGTAGAAGCCGG + Exonic
920783994 1:209022921-209022943 GAGCAGAATGCAGCACAAGCTGG - Intergenic
921564465 1:216699714-216699736 GTTCAAACTGCAACAAAAGCTGG + Intronic
923850176 1:237785780-237785802 GGTCAGTGTGCAGAAGAAGCGGG + Intronic
924539538 1:244968715-244968737 GGTCATCCTGCAGGACAACCAGG + Intergenic
1069832907 10:71291834-71291856 GGCCAGGCTGACGCACAAGCAGG - Intronic
1070593496 10:77816956-77816978 AGTCAGACCGCAGGAAAAGCAGG + Intronic
1071295096 10:84213767-84213789 GGACAGACTCCAGCTAAAGCAGG + Intronic
1073002945 10:100298809-100298831 GGGCAAACTGAACCACAAGCTGG + Exonic
1074186265 10:111101850-111101872 GGTCAGACTCCAGCCCATGGCGG - Intergenic
1075784630 10:125040762-125040784 GGTCAGACTGCAGGTCTACCAGG + Intronic
1078538437 11:12193887-12193909 AGTCAGAGTTCAGCACATGCTGG + Intronic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1085186221 11:74578269-74578291 TTTCAGGCTGCAGCAGAAGCAGG + Intronic
1089030714 11:115325395-115325417 GGTCAAACTGCAATAAAAGCAGG + Intronic
1089438144 11:118489175-118489197 TGACAGACTGCACCACAGGCTGG - Intronic
1090611761 11:128477573-128477595 GGTGAGTCTGCAGTACAGGCAGG + Intronic
1090991065 11:131817456-131817478 GGTCAGGCTGAAGCAAAAGATGG - Intronic
1091252671 11:134156625-134156647 GGGCAGACGTCAGCACCAGCAGG - Intronic
1097220997 12:57451037-57451059 AGGCAGACTACAGCATAAGCAGG - Intergenic
1099097523 12:78393322-78393344 GGACACAATGCTGCACAAGCAGG - Intergenic
1102826491 12:115951550-115951572 GGCCAGACTGCAGTGCATGCAGG - Intergenic
1113547692 13:111166822-111166844 CTTCAGACTTCGGCACAAGCAGG + Intronic
1114319494 14:21535428-21535450 GGTCATACTACAGCACTTGCAGG + Intronic
1118447081 14:65861905-65861927 CATCAGTCTGCAGCCCAAGCCGG + Intergenic
1123931000 15:25171630-25171652 GGCCAGCCTGCAGCACTACCAGG - Intergenic
1123932743 15:25179659-25179681 GGCCAGCCTGCAGCACCACCAGG - Intergenic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1131925577 15:97379716-97379738 GGCCAGCCTGGGGCACAAGCAGG + Intergenic
1141639598 16:85333540-85333562 GGCCAGCCTGCATCAGAAGCTGG + Intergenic
1141700258 16:85639087-85639109 GCTCAGACTGCAGCCCAGGCCGG - Intronic
1142010665 16:87712113-87712135 GGCCACACTGCAGCCCAAGGTGG - Intronic
1144492913 17:15730465-15730487 GGGAAGACTGCAGAACAGGCAGG + Intergenic
1144907341 17:18646194-18646216 GGGAAGACTGCAGAACAGGCAGG - Intronic
1146095422 17:29925677-29925699 GGTCTCACTGTAGCACAGGCTGG - Intronic
1150255164 17:63738801-63738823 TGTCACTCTGCAGCCCAAGCTGG - Intronic
1150599266 17:66636512-66636534 GGTCAGAGTGAAGGCCAAGCTGG - Intronic
1151453353 17:74212532-74212554 GCCCAGGCTGCAGGACAAGCAGG - Intergenic
1152829971 17:82491137-82491159 GGTCAGCCTGGATCACCAGCGGG - Intergenic
1153816264 18:8792911-8792933 GGACAGACATCTGCACAAGCTGG - Intronic
1159628584 18:70723149-70723171 GGGCAGGCTTCAGCAAAAGCAGG + Intergenic
1160926474 19:1549074-1549096 AGTTAGACTGCAGCAAAAACAGG + Intergenic
1166500545 19:43337851-43337873 GGTCAGCCTGGAGCAGCAGCAGG - Intergenic
1166509582 19:43395848-43395870 GGTCAGCCTGGAGCAGCAGCAGG + Intergenic
1166845808 19:45727617-45727639 GGTCACACAGCAACAGAAGCAGG + Intronic
1167486962 19:49768139-49768161 GGTCAGGCAGCAGGACAGGCAGG + Intronic
1167586376 19:50377847-50377869 GCTCAGCCTGCAGCACAGACTGG + Exonic
1167998455 19:53425801-53425823 GCTAAGAATGCAGCACAGGCCGG + Intronic
926792100 2:16584432-16584454 GGTCAGACTGTAGAAGAAGGAGG - Intronic
927695000 2:25233710-25233732 GATCAGATAGGAGCACAAGCAGG - Exonic
928921990 2:36536098-36536120 GCTCAGTCTGAAGCACAAACTGG + Intronic
929950812 2:46408386-46408408 GGGGAGACTGCAGCATGAGCAGG + Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
930248095 2:49005273-49005295 GGTGAGATTTCAGCCCAAGCCGG - Intronic
933472317 2:82741744-82741766 GGTAAGACTGCAACACATTCAGG + Intergenic
933727218 2:85433787-85433809 GGTCAGCCTGGACCACAGGCAGG - Intronic
935792311 2:106603983-106604005 GGAAAGCCTGCAGCAGAAGCTGG + Intergenic
936077772 2:109412571-109412593 GGTGACCCTGCAGCACCAGCAGG - Intronic
937247405 2:120502663-120502685 GGTCAGACAGCACCATCAGCTGG - Intergenic
937787461 2:125918947-125918969 GGGGAGACTGTAGCACAGGCAGG + Intergenic
940750769 2:157625223-157625245 GGGCAGACTGCAGGAAAAGCTGG - Intronic
940990656 2:160092773-160092795 GCTCAGTCTGCAGCATTAGCAGG + Intergenic
945921131 2:215755626-215755648 GGTAAGATGGCAGGACAAGCAGG + Intergenic
948296588 2:236865133-236865155 GGTCACACTGCTGCAAAAGGTGG + Intergenic
1168844604 20:935316-935338 GTTCACACTGCTGCACAACCTGG + Intergenic
1169902959 20:10571433-10571455 GGTGAGACAGCAGCACACTCTGG - Intronic
1171810670 20:29742854-29742876 GGTCGGCCTGCAGCGCACGCAGG - Intergenic
1172525554 20:35599072-35599094 TGAGAGACTGCAGCGCAAGCCGG - Intergenic
1173322625 20:42001842-42001864 GCTGAGACTGCAGCATGAGCTGG - Intergenic
1175966080 20:62660870-62660892 CGTGAGAATGCAGCACAAGCCGG - Intronic
1181104053 22:20561959-20561981 GGTCTCACTGCAGCCCAGGCTGG - Intronic
1181964700 22:26648181-26648203 GGCCAGGCTGCAGCACCTGCTGG + Intergenic
1182613592 22:31570388-31570410 GGAAAGACTGCAGGAGAAGCAGG + Intronic
1182818563 22:33191456-33191478 GGTCAGTCTGATGCACAACCAGG + Intronic
1183362839 22:37391622-37391644 GGTCAGACTGCTGTATCAGCTGG - Intronic
1185140460 22:49098012-49098034 GGAGAGACAGCAGCACATGCTGG - Intergenic
1185223096 22:49639012-49639034 GGCCAGACTGCAGATGAAGCGGG - Intronic
949542082 3:5040608-5040630 TGTCTGTCTGCAGCACAACCAGG - Intergenic
954128610 3:48548049-48548071 GGTCACCCTGCAACAGAAGCTGG - Intronic
954535083 3:51353879-51353901 GGGCAGACTGCATCACCAGTGGG + Intronic
954914131 3:54134711-54134733 TGCCAGACAGCAGAACAAGCCGG + Intronic
955146199 3:56322682-56322704 GTCCAGGCTGCAGCACAAGGAGG + Intronic
958461236 3:94399102-94399124 GGCCATACTGCAGCCAAAGCAGG - Intergenic
961813665 3:129536465-129536487 GCTCACCCTGCAGCCCAAGCAGG + Intergenic
962686746 3:137855244-137855266 AGGAAGACTGCAGCACAGGCTGG + Intergenic
962741402 3:138364859-138364881 GGTCAGACTGCTGCCCATGTGGG - Intronic
969566850 4:7983772-7983794 GGTCAGGCTGCAGGCCAGGCTGG + Intronic
971201193 4:24510812-24510834 GTAAAGACTGCAGCTCAAGCAGG - Intergenic
981043820 4:140247859-140247881 GGAGAGACTTGAGCACAAGCTGG + Intergenic
981952165 4:150422791-150422813 GGGCAAACCGCAGCACATGCAGG - Intronic
982013368 4:151128206-151128228 GGGCAGACTGCAGGACAGGGAGG - Exonic
984717275 4:182937506-182937528 GGTCAGCCTGCAGGACACGAGGG - Intergenic
986572116 5:9176409-9176431 GATGAGACTGCAGCCCTAGCTGG + Intronic
991975337 5:72179256-72179278 GGTCTGAGGGCAGCAAAAGCGGG - Intronic
992677673 5:79121969-79121991 TGTCACACTGCAGCCCAGGCTGG + Intronic
997254842 5:132420471-132420493 GCTCAGAATGCAGCACAAATAGG - Intronic
997690840 5:135826423-135826445 GGTCAGAGTGCTGGACAAGATGG - Intergenic
998780252 5:145647930-145647952 GGTGAGACTGCTGCACAAGCAGG - Intronic
999500744 5:152144282-152144304 CGTCAGAATGAAGAACAAGCTGG + Intergenic
1001881357 5:175246857-175246879 AGTCAGACTGCCCCACAATCTGG - Intergenic
1002516656 5:179764014-179764036 GTCCTGACTGCAGCACATGCAGG + Intronic
1003064511 6:2891853-2891875 CGTCAGGCAGCAGCACCAGCAGG + Exonic
1003622231 6:7710965-7710987 GATAAGACTGCAGCCCAAGCTGG - Intergenic
1009792110 6:68416981-68417003 AGGCAGCCTGCAGCACAATCTGG - Intergenic
1012231792 6:96768658-96768680 GGTCAGACTGCTTCACTAGGTGG + Intergenic
1015419118 6:132986219-132986241 TCTCAGACTGCTGCACTAGCAGG + Intergenic
1018431492 6:163726161-163726183 GTTCAGCTTGCAGCATAAGCAGG - Intergenic
1018709545 6:166488213-166488235 GTTCAGACAGCAGCAAGAGCAGG - Intronic
1018709553 6:166488277-166488299 GTTCAGACAGCAGCAGGAGCAGG - Intronic
1018709558 6:166488309-166488331 AGTCAGACAGCAGCAGGAGCAGG - Intronic
1020033759 7:4951391-4951413 GGTGAGGCTGCAACACAGGCTGG - Intronic
1022182534 7:27935869-27935891 GGTCACACAGCAGCAGAAGTGGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024055759 7:45659039-45659061 GGCCAGAGGGCAGCACAGGCAGG - Intronic
1024834012 7:53495044-53495066 GGGCTGACTGCAGCACTTGCGGG + Intergenic
1037675922 8:21050690-21050712 GGCCAGCCTGCAGCCAAAGCCGG + Intergenic
1038873300 8:31519873-31519895 TCTCAGACTGCTGCACTAGCAGG + Intergenic
1039840749 8:41291312-41291334 AGTCAGGTTGCCGCACAAGCTGG + Intronic
1040000883 8:42575386-42575408 GGTCACCCAGCAGCACCAGCCGG + Intergenic
1040290866 8:46123466-46123488 GGTGAGACTGCAGGAAATGCTGG - Intergenic
1040302738 8:46196333-46196355 GCTGAGACTGCAGGAAAAGCTGG + Intergenic
1040329103 8:46376894-46376916 GGTGAGACTGCAGGAAATGCTGG + Intergenic
1040331619 8:46388571-46388593 GGTCAGACTGCAGGAAACACTGG + Intergenic
1041983414 8:63890837-63890859 GGGCAGACTGTACCACAAACAGG + Intergenic
1043299257 8:78706006-78706028 GGTCAGACTGCTGGTTAAGCAGG - Intronic
1045549026 8:103153697-103153719 GGTCACACTGCTGCTCAGGCTGG + Intronic
1049273808 8:141709696-141709718 GGTCAGAGGGCAGCATGAGCGGG + Intergenic
1049310400 8:141931141-141931163 GGCCAGACTGCAGCTGGAGCAGG + Intergenic
1049614585 8:143570549-143570571 GGTCACACAGCTGCACAAGCTGG - Exonic
1049783833 8:144441079-144441101 GGTCCGGCTGCAGCAACAGCTGG - Exonic
1051346130 9:16152758-16152780 GTTCAGACTCCGGCAAAAGCCGG - Intergenic
1053008020 9:34616926-34616948 GGTGAGACTGAACCACATGCAGG + Intronic
1055080746 9:72265834-72265856 GGTCACACTGATGCACAAGGTGG + Intergenic
1055742778 9:79407998-79408020 GGCCAGACTTCAGCATAGGCAGG - Intergenic
1060002157 9:119968684-119968706 GGTCAGATTGCATCACAAAGAGG + Intergenic
1061064488 9:128268882-128268904 GGTCACTCTGCAGCACAGACTGG - Intronic
1061865430 9:133489620-133489642 GGCAGGACTGCAGCTCAAGCTGG + Intergenic
1062099770 9:134721970-134721992 GCTCAGAGTGCTGCAGAAGCAGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186841764 X:13491712-13491734 GGGTAGACTGCAGTACAGGCAGG - Intergenic
1191773809 X:64790572-64790594 GTTCTGACTGCTGCACAAACTGG + Intergenic
1199362830 X:146943069-146943091 GGTCACACTGATGCAAAAGCTGG + Intergenic