ID: 914582755

View in Genome Browser
Species Human (GRCh38)
Location 1:149033805-149033827
Sequence AGAGAGAATCTAATGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 5, 1: 0, 2: 1, 3: 22, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914582748_914582755 0 Left 914582748 1:149033782-149033804 CCCCAACCACAGGAAATTCTCTG 0: 3
1: 1
2: 2
3: 31
4: 262
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582744_914582755 15 Left 914582744 1:149033767-149033789 CCTATGACACCTCTCCCCCAACC 0: 5
1: 0
2: 7
3: 61
4: 432
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582750_914582755 -2 Left 914582750 1:149033784-149033806 CCAACCACAGGAAATTCTCTGAG 0: 3
1: 1
2: 2
3: 12
4: 205
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582751_914582755 -6 Left 914582751 1:149033788-149033810 CCACAGGAAATTCTCTGAGAGAG 0: 3
1: 1
2: 7
3: 21
4: 263
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582749_914582755 -1 Left 914582749 1:149033783-149033805 CCCAACCACAGGAAATTCTCTGA 0: 3
1: 1
2: 0
3: 22
4: 261
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582746_914582755 6 Left 914582746 1:149033776-149033798 CCTCTCCCCCAACCACAGGAAAT 0: 4
1: 2
2: 8
3: 94
4: 934
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274
914582747_914582755 1 Left 914582747 1:149033781-149033803 CCCCCAACCACAGGAAATTCTCT 0: 3
1: 1
2: 1
3: 39
4: 269
Right 914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG 0: 5
1: 0
2: 1
3: 22
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914582755 Original CRISPR AGAGAGAATCTAATGGCTTG GGG Intronic
902218176 1:14947752-14947774 TGAGAGAATCTGATGGGCTGAGG + Intronic
902639532 1:17757944-17757966 AGAGGGAATCCAAAGGCTTGGGG + Intronic
903188226 1:21641350-21641372 AGAGAAAATGTAAAGGATTGGGG - Intronic
904057876 1:27684282-27684304 AGAGAGAATAAAATGGTCTGGGG - Intergenic
904437284 1:30507051-30507073 AGAGAGAAACTGATGACCTGGGG - Intergenic
906692031 1:47798940-47798962 AGATAGAATCTAGTCGCTTGAGG - Intronic
907056483 1:51373716-51373738 AGACACAATTAAATGGCTTGAGG + Intronic
908600537 1:65734196-65734218 ACATAGAATCTAATGGTGTGAGG - Intergenic
909554382 1:76937156-76937178 AGAGAAAAACAAATGACTTGGGG + Intronic
909780799 1:79544039-79544061 AGACAGATTCTGATGGCTTCAGG + Intergenic
910332455 1:86089950-86089972 AGAGAGAATCTCACGGGCTGTGG + Intronic
910627401 1:89322721-89322743 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
910883681 1:91944566-91944588 TGGGAGGATCTGATGGCTTGAGG + Intergenic
911360639 1:96872251-96872273 AGAGAGAATTTCAAGGCTTAAGG - Intergenic
912015235 1:105026664-105026686 AGAGAGAATCTGTTTTCTTGGGG + Intergenic
912616883 1:111110729-111110751 AGAGAGAATCTCTGTGCTTGGGG - Intergenic
912643817 1:111372251-111372273 AGAGGGAATCTATATGCTTGGGG + Intergenic
913608446 1:120488032-120488054 AGAGAGAATCTAATGGCTTGGGG - Intergenic
913696121 1:121327478-121327500 AGAGAGACCCTGATGGTTTGAGG + Intronic
913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG + Intergenic
914141445 1:144952581-144952603 AGAGAGACCCTGATGGTTTGAGG - Intronic
914370186 1:147017813-147017835 AGAGAGAATCTAATGGCTTGGGG - Intergenic
914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG + Intergenic
914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG + Intronic
917306124 1:173627447-173627469 ACAGAGAATCTATATGCTTGAGG + Intronic
919041091 1:192389565-192389587 ACAGATGATCTAATGGCTTAGGG - Intergenic
920483446 1:206345846-206345868 AGAGAGACCCTGATGGTTTGAGG + Intronic
922275497 1:224073963-224073985 AAAGAGGTTCTATTGGCTTGTGG - Intergenic
923432244 1:233933951-233933973 AGAGATCATCTAATGTTTTGAGG + Intronic
1063814986 10:9760975-9760997 AGAGAGCATCCTTTGGCTTGGGG - Intergenic
1064075379 10:12264570-12264592 AGGGAGGAGCTACTGGCTTGGGG - Intergenic
1064349753 10:14566189-14566211 AAACAGAATCTAATGGATTGAGG + Intronic
1064451428 10:15445400-15445422 AGGAAGAGTCTAATGGCTTTGGG - Intergenic
1064701542 10:18026761-18026783 AGAGAGAATCTTTGAGCTTGAGG - Intronic
1065235301 10:23644544-23644566 AGAGAGAATTTAATGTTTTTGGG + Intergenic
1067200780 10:44170192-44170214 ACAGAGAGGCTCATGGCTTGGGG + Intergenic
1068444149 10:57098377-57098399 AGAGAAAATGCAAAGGCTTGGGG - Intergenic
1071097565 10:81996362-81996384 TGAGATAATCAAATGGCTTATGG + Intronic
1072058665 10:91787361-91787383 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1073175344 10:101552898-101552920 AGAGTGACTCTGATGTCTTGAGG - Intronic
1073393854 10:103202073-103202095 AGAGAGAAGACAATGGCTTGTGG - Intergenic
1073529615 10:104219137-104219159 AGAGAGATACTGAGGGCTTGGGG - Intronic
1075619698 10:123916749-123916771 AGAGAGAATCAAATGGCAGAAGG - Intronic
1077427325 11:2489218-2489240 AGAGAGAATCTGAGAGCTTGGGG + Intronic
1077994882 11:7444681-7444703 CGAGAGTATCTCCTGGCTTGTGG + Intronic
1078365885 11:10706012-10706034 AGAGAGAAGTTAATGCCCTGAGG + Intergenic
1078914998 11:15770687-15770709 AGAGAGAATCCAGGGGCCTGTGG + Intergenic
1080117673 11:28638958-28638980 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
1080900690 11:36487617-36487639 AGACAGAATGTTATGGCTGGAGG + Exonic
1084131602 11:67140057-67140079 AGAGAGAATACCATGGTTTGTGG + Intronic
1085147196 11:74212172-74212194 AGAGAGAATCTGTGTGCTTGTGG + Intronic
1085562658 11:77486608-77486630 AGAGAGAATCTATGTGTTTGGGG + Intergenic
1087032140 11:93716306-93716328 AGAGAGAATCTGTATGCTTGGGG - Intronic
1090095749 11:123740916-123740938 AGACAGCAGCTACTGGCTTGAGG + Intronic
1093370102 12:18355501-18355523 AGAAAGAGTCTATGGGCTTGTGG + Intronic
1093839183 12:23875060-23875082 AGAGAAAATCCACTGTCTTGTGG - Intronic
1094269746 12:28599967-28599989 AAAGAGAATGTAATAGCATGAGG + Intergenic
1094371379 12:29741438-29741460 AGAGAGTATCAAATGACGTGAGG + Intronic
1098183841 12:67876245-67876267 AGGGAGAATATAATTGCTTGGGG + Intergenic
1098518063 12:71401506-71401528 GGAGAGAACCTAGTGCCTTGGGG - Intronic
1099101016 12:78440118-78440140 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1099523209 12:83689399-83689421 AGAGAGAATCTTTGTGCTTGAGG + Intergenic
1099632809 12:85172538-85172560 AATGAGAATCTAAGGGCTTCTGG + Intronic
1099882079 12:88479529-88479551 AGAGAGAATCTAAGCGCTTGGGG + Intergenic
1100904804 12:99285732-99285754 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1104115655 12:125746684-125746706 AGAGGGAATCTCCTGGTTTGCGG + Intergenic
1104146559 12:126039723-126039745 AGAGAGAATCTTGTAGCTTCTGG + Intergenic
1104675077 12:130707045-130707067 AAAGAGAATCTTGTCGCTTGAGG - Intronic
1105419396 13:20239389-20239411 AGAGAGGAGATAATGGCTGGAGG + Intergenic
1106070151 13:26403100-26403122 AGAAAGAATGTGATGGTTTGGGG - Intronic
1107370286 13:39737984-39738006 AGAGAGAATTTATGTGCTTGTGG - Intronic
1110949479 13:81466774-81466796 AGGGAGAATCATATGGCTAGGGG + Intergenic
1112142402 13:96659214-96659236 ATAGAGAATGTAGTGGTTTGGGG + Intronic
1112743209 13:102497773-102497795 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1112861070 13:103830158-103830180 GGAGAGAATCTCTTGGTTTGTGG + Intergenic
1113435002 13:110284301-110284323 AGAGAGATGCTTGTGGCTTGTGG - Intronic
1114341070 14:21744798-21744820 AGAGAGAATCTGATGAACTGAGG + Intergenic
1115434776 14:33360197-33360219 AGAGAGAAACTAATTTCTTCTGG - Intronic
1117851383 14:59974224-59974246 AAAGAAAATCTAATGGAATGAGG - Intronic
1118091287 14:62482654-62482676 AGAGAAAATATAATGGATTTGGG - Intergenic
1118573287 14:67215932-67215954 AAAGCGAATCTAATGGTTTAGGG - Intronic
1118734587 14:68692172-68692194 AGAGATAATTTATTGGGTTGAGG - Intronic
1120100001 14:80434450-80434472 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120467845 14:84884516-84884538 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120504074 14:85332760-85332782 AGATATAATCAAATGGCTAGGGG - Intergenic
1123835189 15:24182800-24182822 AGAAAGAATTTAAGGGCTAGTGG + Intergenic
1124399976 15:29339337-29339359 AAAGACATTCTAATGGCTAGTGG + Intronic
1124602831 15:31149191-31149213 AGGGAGACTCTATTGGCTTTAGG + Intronic
1125513604 15:40306035-40306057 AGAGTAAATATAATGTCTTGTGG + Intronic
1126774658 15:52089956-52089978 AGAGAGAACCTACAGGCTTCTGG + Intergenic
1126979950 15:54229180-54229202 AAAGAGAATCTGAGTGCTTGAGG - Intronic
1127157990 15:56149697-56149719 AGAGGGAATCTCCTGGTTTGTGG - Intronic
1134236376 16:12469496-12469518 AGAGAGAATCAGATGACATGAGG - Intronic
1135957654 16:26969685-26969707 AGAGAGATGATAATGCCTTGAGG - Intergenic
1137801418 16:51265565-51265587 AGGGAGAATCTAGTGGCTTCTGG + Intergenic
1138890841 16:61142490-61142512 AGGGAGAATCTGTTGGCATGGGG - Intergenic
1138961994 16:62038290-62038312 AGCCAGAATCCAATGGCTTTGGG + Intergenic
1140190567 16:72812347-72812369 AGATACAATCTGCTGGCTTGTGG + Intronic
1140800909 16:78487656-78487678 AGATGGTATCTAATGGCTAGAGG - Intronic
1143158260 17:4852734-4852756 AGACAGAATCTACTGGGTGGGGG + Intronic
1146626057 17:34436331-34436353 AGAGAGCATCAAGTAGCTTGGGG + Intergenic
1148204108 17:45768775-45768797 TTAGGGAATCTAATGGCCTGAGG + Intergenic
1151447069 17:74173906-74173928 AGAGAGAAACCAAAGGCTGGAGG + Intergenic
1151895279 17:76976202-76976224 AGTGGGAATCCAATGGCTTTTGG + Intergenic
1153088620 18:1318409-1318431 GGAGAGACTCTTATTGCTTGAGG + Intergenic
1156021675 18:32606544-32606566 AGAGAGAATCTATGTGCTTGGGG - Intergenic
1158024369 18:52878298-52878320 AGAGTGATTCTTATGGGTTGGGG - Intronic
1158922652 18:62211286-62211308 AGAAATAATGAAATGGCTTGAGG + Intronic
1159734138 18:72073549-72073571 GGGGAGAAAATAATGGCTTGAGG - Intergenic
1164398923 19:27889504-27889526 AGAGAGAGACAAATGGGTTGGGG + Intergenic
1166586829 19:43956494-43956516 AGAGAGGATAAAATGGCTGGGGG - Intronic
925588467 2:5486918-5486940 AGAGAGAATCTGTAAGCTTGGGG + Intergenic
925701789 2:6646245-6646267 AGAGAGAATCTACAGTCTTTGGG + Intergenic
926247573 2:11132438-11132460 AGTGAGAATCTGAGGGCTTATGG - Intergenic
926965695 2:18407944-18407966 AGAGAGGATATAATGCCTTATGG + Intergenic
928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
928644306 2:33335652-33335674 AGAGAGACCTTAATCGCTTGTGG + Intronic
928941703 2:36733401-36733423 AGAGAGAATCTAATTGCATCAGG + Intronic
929150753 2:38746476-38746498 AGAAAGAAGCTTATGACTTGGGG - Intronic
929605459 2:43231203-43231225 ACAGAGCATCTCAGGGCTTGGGG + Exonic
931255262 2:60566401-60566423 TGACAGAATCTAATGGGTTGAGG + Intergenic
931976302 2:67647338-67647360 AGAGACAATCTTATTGATTGTGG - Intergenic
932139210 2:69260763-69260785 AGAAAGGATCAAAAGGCTTGGGG + Intergenic
932299445 2:70655844-70655866 AGGGAGAAACTGATGGCTTTGGG + Intronic
933424169 2:82088698-82088720 AGAGTGAAGCCAATGGCTTCAGG + Intergenic
934637629 2:96005237-96005259 AGAGAGAATCTCTAAGCTTGAGG - Intergenic
934928857 2:98404021-98404043 AGAGAGAATCTGTGTGCTTGTGG + Intergenic
935816985 2:106855301-106855323 AGAGAGAAACAAATGCCATGTGG - Intronic
936901463 2:117485814-117485836 AGAGAGAATCTATGTGCTTGTGG - Intergenic
938608448 2:132921325-132921347 AGGGAGAATCTACAGGATTGAGG - Intronic
939721023 2:145651489-145651511 AAAGAATATCTAATGACTTGGGG - Intergenic
939854867 2:147346102-147346124 AAAGTGAATCTAATGGACTGTGG - Intergenic
941684499 2:168434569-168434591 AGAGAGAATATATTTGTTTGGGG - Intergenic
942975870 2:182016197-182016219 AGAGAGAATCTGTGTGCTTGTGG - Intronic
943016882 2:182523325-182523347 AGAGAGAAACTGATGGTTTGCGG + Intergenic
943099661 2:183472247-183472269 AGAGAGAATCTTTAGGCTTGGGG - Intergenic
944287342 2:197966570-197966592 AGAGAGAATCTATGTGCCTGGGG - Intronic
944918703 2:204388241-204388263 AGAGAGCATCTAATGGTGAGGGG - Intergenic
945334319 2:208573467-208573489 AGAGAGAATCTGTGTGCTTGGGG + Intronic
946162907 2:217846920-217846942 AGATAGAGCCTAAGGGCTTGAGG + Intronic
946899957 2:224362723-224362745 AGACAGCATCTGATGGCTTCTGG + Intergenic
1170131279 20:13022776-13022798 AGAGAAAGTCTAGTGGATTGTGG - Intronic
1170582807 20:17711667-17711689 TAAGAGCAACTAATGGCTTGCGG - Intronic
1171146862 20:22792196-22792218 AGAGAGAAGCTGACGGCCTGTGG - Intergenic
1172814226 20:37673573-37673595 AAAGAGAAGATAATGGATTGGGG + Intergenic
1172936556 20:38624636-38624658 AGAGAGAACCAAAGGACTTGAGG - Intronic
1173260581 20:41431489-41431511 AGAGAGAATGTTATGGATTCTGG - Intronic
1173361981 20:42352736-42352758 ACAGAGAAGATAATTGCTTGAGG + Intronic
1173830767 20:46085767-46085789 AGGAAGAATCTAGTGGCTAGAGG + Intronic
1178234630 21:30826964-30826986 AGATAGAATCTAAAGTCTTATGG + Intergenic
1181896078 22:26108869-26108891 AGAGAGAATCAAATGGAATTGGG - Intergenic
1184482180 22:44754128-44754150 AGAGAGAATCCAAGGGTTTGTGG + Intronic
1184874504 22:47264964-47264986 AGACAGAATCAAATGGCTGATGG + Intergenic
949110814 3:258219-258241 AGAGAGAATATTGTGTCTTGGGG + Intronic
949328595 3:2895704-2895726 AGAGACAATCTAAAGGCTAAAGG + Intronic
949623101 3:5838039-5838061 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
950219006 3:11180220-11180242 AGAGTGAGTGTAATGGCTGGAGG - Intronic
950707572 3:14792569-14792591 AGAGAGAAGCAAAAGGCTTTTGG + Intergenic
951437100 3:22677212-22677234 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
953468507 3:43146554-43146576 AGAGGGAAGCTGATGGGTTGGGG + Intergenic
958958437 3:100486743-100486765 AGATAGATTCTGATGGTTTGTGG - Intergenic
959478425 3:106840109-106840131 AGATAGAACAGAATGGCTTGTGG - Intergenic
960354057 3:116629268-116629290 AGAGAGAATCTGTATGCTTGGGG - Intronic
961074067 3:123965303-123965325 AGAGAGCACTAAATGGCTTGAGG - Intergenic
961309558 3:125986829-125986851 AGAGAGCACTAAATGGCTTGAGG + Intergenic
962108812 3:132420405-132420427 GGAGAGAATCTTATGCCTGGAGG + Intronic
962997971 3:140650696-140650718 AGAGAGAATGTATGTGCTTGGGG + Intergenic
963020598 3:140869484-140869506 AGAGATAATCTATGTGCTTGGGG - Intergenic
963467382 3:145700653-145700675 AGAGAGGATATAATGACTTCAGG - Intergenic
963490249 3:145991058-145991080 AGAAAGAAACAAATGTCTTGGGG - Intergenic
963701278 3:148629962-148629984 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
965020208 3:163218875-163218897 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
965145114 3:164890838-164890860 AGAGAGAATTTATGTGCTTGCGG - Intergenic
965254927 3:166394363-166394385 AGAAAGAATCTCAGAGCTTGAGG - Intergenic
965379138 3:167966751-167966773 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
965566871 3:170128987-170129009 AGAGACAATCTGCTGGCCTGGGG + Exonic
966061229 3:175759316-175759338 AGAGAGAAAGTATTGTCTTGTGG + Intronic
966141825 3:176766275-176766297 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
966151104 3:176868595-176868617 AGAGAGACTCCATTGGCTTGAGG + Intergenic
966151227 3:176869310-176869332 AGAGAGACTCTGTTGGTTTGGGG + Intergenic
966227017 3:177608725-177608747 AGAGAGTCACTAATGGCTTTGGG - Intergenic
966614780 3:181901883-181901905 AAAGGGAATCTAATGGGTAGAGG + Intergenic
967062911 3:185888553-185888575 ATAGTGAATCAAATGGCTGGAGG + Intergenic
972442857 4:39113727-39113749 AGAGAGAATTGAATGGATTTAGG + Intronic
972779367 4:42272798-42272820 AGAGTGAATATGATGGTTTGTGG + Intergenic
972841128 4:42931395-42931417 AGAGAAATTCTAATGGCAGGTGG - Intronic
974224363 4:59019251-59019273 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
975370123 4:73575605-73575627 AGAGAGAATAAAAGGGCTGGGGG + Exonic
976199424 4:82563656-82563678 AGAGAGAAATGAATGGCATGGGG - Intergenic
976273265 4:83250992-83251014 AGAGAGACTCCAAAGGCTTAGGG - Intergenic
978258179 4:106718131-106718153 AGAAAGAATCTATGTGCTTGGGG + Intergenic
979945721 4:126829511-126829533 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
980227031 4:129999455-129999477 AGAGAGACTCTATTTGTTTGGGG + Intergenic
980596823 4:134965894-134965916 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
981131529 4:141162807-141162829 TGAGAGAATCTCCTGGTTTGTGG - Intronic
981394592 4:144233231-144233253 AGAGAGAATCTGTTTGCTTCAGG + Intergenic
982299010 4:153859869-153859891 TGAGAGAATCTCCTGGTTTGTGG + Intergenic
982937900 4:161508164-161508186 AGAGAAAATAGACTGGCTTGAGG - Intronic
983809928 4:172049392-172049414 AAGGATAATCTAATGGCATGTGG - Intronic
986885340 5:12226776-12226798 AGAGAGAATCTGTATGCTTGAGG - Intergenic
988961878 5:36378864-36378886 AAAGAGGATCTAATGTCTTGTGG + Intergenic
989286891 5:39710852-39710874 AAAGAGAATCTAATGAAATGAGG - Intergenic
991236646 5:64406958-64406980 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
992666925 5:79019514-79019536 AGAGAAAATCTAATTGATTTGGG + Intronic
994627657 5:102242016-102242038 AGAGAGAATCTCTTGGGGTGGGG + Intronic
994965680 5:106668104-106668126 AGAGAAAATCTGATGGTCTGTGG + Intergenic
995019478 5:107351418-107351440 AGAGAGACTCTATTTGTTTGGGG - Intergenic
995019720 5:107352886-107352908 AGAGAGAATCTATGTGTTTGGGG - Intergenic
995428007 5:112045826-112045848 AGAAGGGATCTAAAGGCTTGAGG - Intergenic
996324124 5:122252891-122252913 GGAGAGAATCTCCTGGTTTGTGG + Intergenic
996867112 5:128137445-128137467 AGAGAGAATCTAATTCAATGTGG - Intronic
997104506 5:131003900-131003922 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
997273334 5:132560848-132560870 AGAGAAAAGGTAATGGCTAGAGG - Intronic
998859527 5:146428838-146428860 AAAGAGCATGTCATGGCTTGAGG + Intergenic
999258247 5:150221968-150221990 AGAGGGAATCTAATTGTTTTTGG - Intronic
1001845250 5:174916421-174916443 AGAGAGAATCTACGCACTTGGGG + Intergenic
1002009881 5:176270645-176270667 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1002216845 5:177641663-177641685 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1002770740 6:288727-288749 AGTGAGAATCTAATGAATTGTGG - Intergenic
1004058397 6:12164328-12164350 AGAGAGAGTCTGCTGGCCTGAGG - Exonic
1005165793 6:22918892-22918914 AGAAAGAATCTCATGGAATGAGG - Intergenic
1005175629 6:23041359-23041381 AGAAAGAATCTAAAGGCTTACGG + Intergenic
1008101152 6:47392519-47392541 AGAGAGATTCTATGTGCTTGGGG - Intergenic
1008368128 6:50706274-50706296 AGGTAGAATCTGATGGCTTCTGG + Intergenic
1010434556 6:75814225-75814247 TGAGAGAATCTACAGGCTTGTGG - Intronic
1011343135 6:86339790-86339812 AGAGAAAATCTGTTTGCTTGGGG + Intergenic
1012057117 6:94427176-94427198 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1012592360 6:100998137-100998159 AGATCGAATGTAATGGGTTGTGG - Intergenic
1013373571 6:109491833-109491855 AGGGAGAATCACATGGCTTTTGG + Intergenic
1013916421 6:115343915-115343937 AGAGAAACTGTAATGGCTGGAGG + Intergenic
1014603090 6:123440217-123440239 AGAGATAATCTAATGTCTCAGGG + Intronic
1014794601 6:125710301-125710323 AGAGAGAATCTGACTGCTTGGGG + Intergenic
1016541373 6:145169944-145169966 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1017041177 6:150309768-150309790 AGAGAGAAATTAATGACTTTGGG + Intergenic
1020574939 7:9914021-9914043 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1021123848 7:16827057-16827079 AGAGAGACTCTGTTTGCTTGTGG + Intronic
1021211789 7:17863008-17863030 AAAGAGAATCTGTGGGCTTGTGG + Intronic
1021368878 7:19816498-19816520 AGAGAGAGTCTAAACTCTTGAGG + Intergenic
1022799531 7:33762377-33762399 AGAGAGAACTTGAAGGCTTGAGG + Intergenic
1023240865 7:38146179-38146201 AGAGAGAATCTGTATGCTTGAGG + Intergenic
1023670907 7:42575608-42575630 AGAAAAAAACTCATGGCTTGAGG - Intergenic
1024152917 7:46591017-46591039 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
1025768947 7:64485446-64485468 ATCTAGAATCTAATGGCTTTAGG - Intergenic
1028353523 7:89879038-89879060 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1028580918 7:92409000-92409022 AGAAAGAAGGAAATGGCTTGGGG - Intergenic
1029802091 7:102959314-102959336 AGATAGAATTTAATGGAATGGGG - Intronic
1030990222 7:116290825-116290847 AGAGAGAATCTGTATGCTTGAGG + Intronic
1031565833 7:123296149-123296171 AGAGAGAATCTGTATGCTTGGGG + Intergenic
1031658015 7:124381821-124381843 AGAGATCATTTAATGTCTTGAGG - Intergenic
1031721806 7:125186621-125186643 AGAGAGAATCTCTGTGCTTGGGG + Intergenic
1032063091 7:128741133-128741155 AGTGAGAATCTAGGGCCTTGTGG - Intronic
1032320431 7:130881562-130881584 AGACACATTCTCATGGCTTGTGG - Intergenic
1032633208 7:133676677-133676699 AGAGAGAAAAGAATGCCTTGGGG - Intronic
1033813952 7:145050528-145050550 AGAGAGACTCTATTTGCCTGGGG - Intergenic
1037040452 8:14224883-14224905 AGAGAATATTTAGTGGCTTGAGG - Intronic
1037520054 8:19671858-19671880 AAAGAATATTTAATGGCTTGGGG - Intronic
1037897299 8:22666441-22666463 AGAGAGAAGCATTTGGCTTGAGG + Intronic
1038841668 8:31189968-31189990 AGAGAGAATGTATTGATTTGTGG + Intergenic
1041606821 8:59792011-59792033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1042428069 8:68672437-68672459 AGAGAGAATCTGTGGGCTTAGGG + Intronic
1042808977 8:72803402-72803424 AGAGTGACTATAATGGCTTTTGG - Intronic
1043044090 8:75299340-75299362 AGAGAGAATATAATGTTTAGAGG + Intergenic
1046542419 8:115603762-115603784 AGAGTGATTCCAATGACTTGGGG - Intronic
1047643655 8:126847051-126847073 AGAGAGATTCCAAAGGCCTGAGG + Intergenic
1050930280 9:11313467-11313489 AGAGAGAATCTGAATACTTGGGG - Intergenic
1051211607 9:14750837-14750859 AGAGAGAATTTATGGGCTGGGGG + Intronic
1051469709 9:17423832-17423854 AGAGAGAATCTGTGTGCTTGGGG - Intronic
1051636625 9:19186624-19186646 AGAGATATTATAATGTCTTGAGG - Intergenic
1051969807 9:22874910-22874932 AGAGAGAAACTAATGGGTCGTGG - Intergenic
1053592697 9:39530525-39530547 TGAGAGAATCCAATTCCTTGTGG - Intergenic
1053850433 9:42285248-42285270 TGAGAGAATCCAATTCCTTGTGG - Intergenic
1054573605 9:66834751-66834773 TGAGAGAATCCAATTCCTTGTGG + Intergenic
1054978419 9:71175230-71175252 AAAGAGAAGTAAATGGCTTGTGG + Intronic
1057084506 9:92196662-92196684 AGAGAGAATCTATGTTCTTGGGG + Intergenic
1059838966 9:118191176-118191198 AGAGAGAATCTGTACGCTTGAGG + Intergenic
1060159114 9:121343949-121343971 ACAGAGAATGAAATGGTTTGGGG + Intronic
1186333689 X:8563584-8563606 AGAGAGAAAGAAATGGCTTTTGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187575130 X:20546019-20546041 AGAGAGAATCTGTCTGCTTGGGG - Intergenic
1187674287 X:21700481-21700503 GAAGAGAATCTGGTGGCTTGGGG - Intergenic
1188421232 X:29992542-29992564 AGAGAGAATCTGTGGACTTGCGG - Intergenic
1190122601 X:47674573-47674595 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1190361320 X:49651733-49651755 AGAGAGAATCTTATCTCCTGTGG - Intergenic
1191097483 X:56688748-56688770 AGAGGGAATCTCTTGGTTTGTGG + Intergenic
1191194068 X:57703077-57703099 AGAGAGACTCCATTTGCTTGAGG - Intergenic
1191819780 X:65292497-65292519 AGAGAGGATCTAATGGATGCTGG + Intergenic
1191941508 X:66485915-66485937 GGAAAGAATCTAAAGGCTTAGGG - Intergenic
1192045889 X:67674144-67674166 AGAGAGACTCTATTTGTTTGGGG - Intronic
1193335578 X:80285011-80285033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1193366833 X:80644379-80644401 AGAGAGAATCTATGCACTTGGGG - Intergenic
1193658343 X:84225252-84225274 AGAGAGAATCTATGTACTTGTGG - Intergenic
1193750519 X:85337295-85337317 AGAGAGAATCTGTGTGCTTGAGG - Intronic
1194398087 X:93411428-93411450 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1195346546 X:103955530-103955552 AGAAAGAATCTCAGAGCTTGAGG + Intronic
1195414173 X:104602327-104602349 AGAGGGAATCTCCTGGTTTGCGG - Intronic
1195477442 X:105303064-105303086 AGAGAGAATCAAGTGGTTTGGGG - Intronic
1196485711 X:116204187-116204209 AGAGAGAATCTATGCGCTTTGGG - Intergenic
1197399866 X:125977332-125977354 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1197524414 X:127544858-127544880 GGACTGAATCTAATGGATTGAGG - Intergenic
1198635861 X:138699528-138699550 AGCCAGATTCTAGTGGCTTGAGG - Intronic
1198679024 X:139161488-139161510 AGAGAGAGTATATTGTCTTGTGG - Intronic
1198972249 X:142295443-142295465 AGAGGGACTCGAATTGCTTGTGG + Intergenic